El pelo cano y el análisis de ADN

El 3 de enero de 1996 se cerró el sumario, sin hacer ninguna otra investigación sobre Miguel Nicolas Cortona y sus declaraciones sobre los hechos .

El 16 de febrero de 1996 la Asociación Clara Campoamor, como acusación popular, pidió ampliatorias del sumario; por si el sumario fuera poco confuso, aparece la respuesta de la Audiencia Provincial (folios 3.670-3.673) antes que la petición (rollos de sala, ff. 169-171). En esta petición (expuesta con meridiana claridad), se dice que no se puede cerrar el sumario amparándose en que entonces habría un retraso indebido, ya que las pruebas que se piden son necesarias para que el proceso sea justo.

Esta petición consiguió que el cierre del sumario fuera revocado.

La ampliatoria solicitaba lo siguiente:

  • Se certificara si Cortona estaba en la cárcel la semana del 13 al 20 de noviembre de 1992 (fechas en las que desaparecieron Míriam, Toñi y Desirée).
  • En el caso de que no estuviera en la cárcel, que se le cite como imputado y se le extraigan pelos de la cabeza y el pubis para que se haga una pericial junto con los pelos de Ramón Antonio Losa Raga y José Miguel Martínez Cana. La pericial consistiría en comparar los pelos de estos tres individuos con los pelos dubitados hallados. Se pidió que la comparación fuera de las características microscópicas y análisis de queratina, porque creían que los pelos hallados no tenían restos suficientes para hacer un análisis de ADN.

La respuesta de la audiencia provincial fue que:

  • Efectivamente, Cortona no estaba en la cárcel en esa época.
  • Se le citó a declarar como imputado y le pidieron muestras de pelo de la cabeza y del pubis para compararlos solo con el pelo cano de 4 cm de longitud hallado por el Dr. Frontela en el cinturón de Desirée. Se hará análisis microscópico, de queratina y ADN.
  • No se permite la comparación de los pelos dubitados con Ramón Losa Raga ni con José Miguel Martínez Cana, porque no sería eficaz para el esclarecimiento de los hechos, ya que estos pelos no tenían bulbos y la audiencia creía que no era posible entonces hacer un análisis de ADN.

Algo totalmente falso cuando se trata de estudios de ADN mitocondrial, donde el bulbo no es necesario. Como podemos leer en el siguiente resumen:

ESTUDIO DE ADN MITOCONDRIAL

El ADN mitocondrial es útil en investigación forense porque resiste condiciones adversas sin que la célula se degrade y se conserva mejor en el tiempo. Estas 2 características garantizan las estabilidad postmortal y una mayor resistencia que el nuclear.

Este tipo de ADN se utiliza sobre todo en los casos siguientes:

Cuando la cantidad de muestra de que se dispone es mínima (pelos sin bulbo por ejemplo). Un pelo con bulbo caduco o un fragmento de pelo contendrá una cantidad de ADN nuclear tan escasa que en principio los análisis de estas muestras mediante ADN nuclear resultará negativo.

En el único caso que no serviría un pelo que carezca de bulbo, sería en el estudio  de ADN nuclear.

La petición era que compararan los pelos solicitados a Cortona, Losa Raga y Martínez Cana con los pelos dubitados. En lugar de eso, el juzgado de instrucción nº 6 de Alzira obliga a comparar solo los pelos de Cortona con el pelo cano hallado por el Dr. Frontela en el cinturón de Desirée. ¿Por qué? El único de los pelos dubitados con bulbo era la cana hallada por Frontela. Algunos podrían pensar que Cortona era el único del entorno de Ricart y Anglés con la edad suficiente para tener canas. Pero Miguel Nicolás Cortona no tenía canas, como puede apreciarse en las imágenes que hemos encontrado de 1996 y 1997, 4 y 5 años después de los hechos. Los testimonios de la época lo corroboran. El problema real de la comparación de ese pelo púbico canoso era que la deficiente instrucción se limitó exclusivamente al entorno de Miguel Ricart y Antonio Anglés. Así, aunque había un pelo canoso, no podían compararlo con nadie que tuviera el pelo cano. Por tanto, la acusación popular decidió que se comparase con Miguel Nicolás Cortona para que no se cerrara el sumario y que por lo menos se hiciera algo con unos pelos que habían aparecido en los cadáveres, ya que la juez instructora quería cerrar el sumario sin hacer nada más.


SUMARIO

FOLIOS 3670 -3673

AUDIENCIA PROVINCIAL VALENCIA -SECCIÓN SEGUNDA
SUMARIO 1-93 – Juzgado Inst. Alzira 6.
AUTO

Iltmos. Señores:
Don Francisco Monterde Ferrer, Don Mariano Tomás Benítez y Dña. Carmen Llombart Pérez
En la ciudad de Valencia, a dieciséis de febrero de mil novecientos noventa y seis.
Dada cuenta; y concurriendo los siguientes

HECHOS

PRIMERO.-Con fecha 3de enero de 1996 por el Juzgado de Instrucción n° 6 de Alzira fue declarado concluso el Sumario 1/93, seguido por los delitos de Rapto, Violación, Asesinato, Inhumación ilegal y Tenencia ilícita de Armas por los que se encuentra procesado y en situación de prisión provisional desde el 31-1-93 (prorrogada en 18-1-95) MIGUEL RICART TÁRREGA, elevándose el sumario y las piezas de convicción.

SEGUNDO: Conferido el trámite de instrucción a las partes comparecidas, el procurador D. Juan Antonio Ruiz Martín en nombre de la acusadora popular Asociación Clara Campoamor, en 9-2-96, instó la revocación del sumario con objeto de que se practicaran las siguientes diligencias y por el siguiente orden:

1º) Oficio a la Dirección General de Instituciones Penitenciarias para que certifique sobre MIGUEL NICOLÁS CORTONA los siguientes extremos:

  1. Si durante el año 1992 estuvo internado en algún centro penitenciario.
  2. Si lo estuvo que se indique el periodo o periodos, en el caso de que hubiere ingresado en varias ocasiones.
  3. Si estaba en calidad de penado, se informe sobre los permisos que se le concedieron y disfrutó, o bien ,sobre el grado penitenciario y si el régimen era de carácter abierto, señalando expresamente tanto para los permisos como para el cumplimiento en régimen abierto la fecha de inicio y de finalización y sus horarios.

2°) De encontrarse en prisión, sin régimen abierto, y sin permiso en el periodo comprendido entre el día 13 al 20 de noviembre de 1992, se renuncia al resto de las pruebas propuestas. Por el contrario de encontrarse en prisión se solicita que sea citado a declarar en concepto de imputado, se solicite la extracción de pelos de cabeza y del pubis para la práctica de la perícial que ha de versar no sólo sobre los pelos de Miguel Nicolás Cortona, sino también sobre los pelos que no han sido examinados hasta ahora de Ramón Antonio Losa Raga y José Miguel Martínez Cana.

La pericial consistirá en la comparación de las características microscópicas y peculiares, junto al análisis de queratinas, dado que los pelos dubitados carecen de restos suficientes para la identificación de ADN.

Debiéndose realizar su práctica, para observar la mayor diligencia, en un centro de Valencia, bien la Clínica Forense, bien la unidad de Medicina Legal de la Universidad de Valencia o el Centro de Investigación Grisolía de esta capital.

TERCERO: El Procurador D. Francisco García Albert en representación de la defensa del procesado Miguel Ricart Tárrega en 15-2-96, manifestó:

  1. A) que no había podido proponer determinadas pruebas dada la imposibilidad de comunicación con su defendido interno en el Centro de Herrera de la Mancha en la provincia de Ciudad Real, tras haberse denegado por la instructora su traslado al Centro Penitenciario de Castellón. B) Que recientemente su defendido le había solicitado que se llamase a declarar a determinadas personas que podrían esclarecer los hechos, por lo que entiende necesaria la revocación del sumario.
  2. C) Que se adhiere a la petición de la Asociación Clara de Campoamor en base a la necesidad de esclarecer autorías.

Y siendo de aplicación los siguientes

RAZONAMIENTOS JURÍDICOS

PRIMERO: Dadas las peticiones de revocación del auto de conclusión del sumario efectuadas por una de las acusaciones populares, y por la defensa del acusado -a quien se dio el trámite del arto 627 de la LECr efectuando una interpretación integradora del mismo, de conformidad con los arts. 24 CE.,5.l y 7.2 de la LOPJ. con objeto de garantizar el equilibrio procesal entre las partes en la fase intermedia, según ha indicado el TC. en sentencias como la de 22-3-85 ó l7-4-89 -habiendo informado la Subdirección General de Gestión Penitenciaria que Miguel Nicolás Cortona estuvo preso exclusivamente entre el 27 de noviembre y el 14 de diciembre de 1992, no puede entenderse completa la instrucción sumarial, y se accede a la revocación de su conclusión, con objeto de que a la mayor brevedad, y teniéndose en cuenta las limitaciones temporales impuestas por la prisión preventiva del procesado, se lleven a cabo las siguientes diligencias de entre las solicitadas:

1°) Se constate la realidad de la información sobre la prisión de Nicolás Cortona.

2°) De confirmarse lo anterior ,que sea citado a declarar en concepto de imputado MIGUEL NICOLÁS CORTONA, solicitándose la extracción de pelos de su cabeza y pubis para la práctica de la pericial consistente en la comparación del ADN. y características microscópicas y peculiares y de queratinas, en su caso, con el pelo hallado por el Dr. Frontela en el cinturón de Desirée Hernández, de unos 4 cms de longitud y cano, durante la autopsia de su cadáver.

3°) El pelo hallado, de no haber sido devuelto al Juzgado instructor por el Dr. Frontela, deberá serle reclamado, llevándose a cabo los correspondientes estudios y análisis por la Clínica Médico-Forense de Valencia, o por el centro u organismo debidamente capacitado que la misma determine.

4°) Se facilite en la medida de lo posible la comunicación del procesado con su letrado, eliminándose cualquier atisbo de indefensión.

5°) Deberá darse cuenta puntual y semanalmente a este Tribunal de las causa que en cada momento impidan la terminación de la instrucción, conforme a las previsiones del art.324.1 LECr.

SEGUNDO: Por no considerarse eficaz para el esclarecimiento de los hechos, no ha lugar a la práctica de la pericial solicitada referente a Ramón Losa Raga y a José Miguel Martínez Cana, dados los informes obrantes en autos, y el contenido de los mismos donde se precisa la falta de bulbo de las muestras de pelos dubitados, y la imposibilidad de llevar a cabo con ellos pruebas de ADN. así como el carácter meramente complementario, no identificativo y de simple valoración de frecuencias, del examen de queratinas que se pudiera realizar.

Por todo ello,

VISTOS los arts. citados y demás de aplicación.

PARTE DISPOSITIVA

LA SALA ACUERDA, revocar el auto de conclusión del sumario dictado con fecha 3-1-96 por la Sra. Juez de instrucción n° 6 de Alzira con objeto de que se lleven a cabo las diligencias antes expresadas y las demás que fueren estrictamente necesarias para el esclarecimiento de los hechos.

FOLIOS 3733- 3734

DILIGENCIA PARA HACER CONSTAR.-

En Valencia a las diecisiete horas del día veintinueve de febrero de mil novecientos noventa seis, por medio de la presente la fuerza instructora quiera hacer constar que de las gestiones que se han practicado a raíz de lo manifestado por MIGUEL NICOLÁS CORTONA, las mismas dan como resultado lo siguiente:

MIGUEL RICART TÁRREGA, ingresó en la Prisión Modelo de Valencia el día 04 de Diciembre de 1.992 por el Procedimiento Abreviado 263/62 del Juzgado de lo Penal nº NUEVE, permaneciendo hasta el día 22 de Diciembre de 1.992.

MIGUEL NICOLÁS CORTONA, ingresó en la Prisión Modelo de Valencia el día 27 de Noviembre de 1. 992, por las Diligencias Previas nº 4.403/92 del Juzgado de Instrucción nº DOS de Valencia, permaneciendo hasta el día 14 de Diciembre de 1.992.

Por lo que ambos permanecieron juntos en la misma celda de la Prisión durante los días del 4 al 14 de Diciembre de 1.992, fecha que salió de la misma MIGUEL NICOLÁS CORTONA.

Y para que conste se extiende por diligencia que firma la fuerza instructora de las presentes. CONSTE Y CERTIFICO.-

DILIGENCIA DE ENTREGA.-

En Alzira (Valencia) a las doce horas del día uno de Marzo de mil novecientos noventa y seis, personada la fuerza instructora de las presentes diligencias en el Juzgado de Instrucción nº SEIS de ALZIRA (Valencia), se hace entrega de las presentes las cuales constan de SIETE folios útiles escritos por una sola, uniéndose a las presentes copia para el Excmo. Sr. Fiscal Jefe del Tribunal Superior de Justicia de la Comunidad Autónoma Valenciana.

Y para que conste se extiende por diligencia que firma la fuerza instructora.

CONSTE Y CERTIFICO.

ROLLOS DE SALA

FOLIOS 423 – 426
AUDIENCIA PROVINCIAL VALENCIA – Sección Segunda
SUMARIO 1-93 Juzgado Inst. Alzira 6. ALCÁCER
AUTO

Ilmos. Señores: Don Francisco Monterde Ferrer, Don Mariano Tomás Benítez y Dª.Carmen Llombart Pérez

En la ciudad de Valencia, a uno de julio de mil novecientos noventa y seis.
Dada cuenta; y concurriendo los siguientes

HECHOS

 PRIMERO.- Con fecha -15-1-1996 por el Juzgado de Instrucci6n nº 6 de Alzira (tras su revocación en 19-1-95) fue declarado por segunda vez concluso el Sumario 1/93, seguido por los delitos de Rapto, Violación, Asesinato, Inhumación Ilegal y Tenencia Ilícita de Armas por los que se encuentra procesado y en situación de prisión provisional desde el 31-1-93(prorrogada en 18-1-95) MIGUEL RICART TÁRREGA elevándose el sumario y las piezas de convicción.

A instancia de la Acusadora popular Asociación Clara Campoamor y con la adhesión de la defensa del procesado la Sala acordó por auto de 16-2-96 la revocación del sumario, el cual fue declarado concluso de nuevo en 3-5-96, manifestando la instructora haber practicado las diligencias encomendadas a excepción de la pericia consistente en la comparación del ADN mitocondrial y características microscópicas y peculiares y queratinas entre pelos de la cabeza y pubis de MIGUEL NICOLÁS CORTONA y el hallado en el cinturón de DESIRÉE HERNÁNDEZ por falta de los medios técnicos adecuados en España.

 

SEGUNDO: Conferido de nuevo el trámite de instrucción a las partes comparecidas, el Ministerio Fiscal manifestó su conformidad con la conclusión del sumario, dándose por instruido en 10-5-96, pero el procurador D. Juan Antonio Ruiz Martín en nombre de la Acusadora Popular Asociación Clara Campoamor, en 22-5-96, instó la revocación del sumario con objeto de que se practicara la prueba pericial en su día acordada, adhiriéndose a dicha solicitud en 24-5-96 el Procurador Dª- Ana María Arias Nieto en nombre de la Acusadora Popular Dª. Lourdes Alonso Beltza.

TERCERO: Con fecha 17-5-96 el Procurador D. Higinio Recuenco Gómez en nombre de los Acusadores Particulares D. Fernando García Mediano, D. Fernando Gómez Moreno y D. Vicente Hernández Blasco, manifestó haber quedado instruido y no tener nada que oponer a la conclusión del sumario. Sin embargo, habiendo renunciado los últimos a su representación y defensa haciéndose cargo de ellas el Procurador Dª. Isabel Caudet Valero y el Letrado D. Vicente-Ignacio Attard Torró – si bien, por fallecimiento (en 18-6-94) de D. Vicente Hernández Blasco su esposa Dª. Rosa Folch Romaguera se ha tenido por apartada del procedimiento – tras solicitar y concedérsele plazo para instruirse , en 19-6-96 instó la revocación del sumario concretando en escrito de 28-6- 96 las diligencias que interesaba consistentes en el análisis comparativo del ADN mitocondrial de diversos vellos púbicos hallados sobre los cadáveres de las fallecidas y los obtenidos de algunos sospechosos, así como el pelo cano hallado en el cinturón de Desirée y los que se extraigan a Miguel Nicolás Cortona, interesando que se llevara a cabo la pericia por el Dr. Frontela de Sevilla en colaboración con el departamento de Medicina Legal de Santiago de Compostela.

CUARTO: El Procurador D. Francisco García Albert en representación de la defensa del procesado Miguel Ricart Tárrega en 26-6-96, manifestó que se tuviera por instada la revocación del sumario y se acordara la práctica de las diligencias que en su día se acordaron y están pendientes, así como las demás interesadas por las partes en el procedimiento.

Y siendo de aplicación los siguientes

RAZONAMIENTOS JURÍDICOS

 PRIMERO: Dadas las peticiones de revocación del auto de conclusión del sumario efectuadas por las acusaciones populares por la acusación particular y por la defensa del acusado – a quien se dio el trámite del art. 627 de la LECR efectuando una interpretación integradora del mismo, de conformidad con los arts 24 CE.,5.1 y 7.2 de la LOPJ. con objeto, de garantizar el equilibrio procesal entre las partes en la fase intermedia, según ha indicado el TC. – en sentencias como la de 22-3-85 6 17-4-89-, habiendo informado la Unidad Docente de Medicina Legal de la Universidad de Valencia que cuenta con personal y con los medios técnicos (en colaboración con el Departamento de Medicina Legal de la Universidad de Santiago de Compostela) adecuado, no puede entenderse completa la instrucci6h sumarial, y se accede a la revocación de su conclusión, con objeto de que a la mayor brevedad, y teniéndose en cuenta las limitaciones temporales impuestas por la prisión preventiva del procesado, se lleven a cabo las siguientes diligencias de entre las solicitadas:

1º)Tras la obtenci6n de pelos de cabeza y pubis de MIGUEL NICOLÁS CORTONA se practique la pericial consistente en el análisis comparativo del ADN mitocondrial y características microscópicas y peculiares y de queratinas, en su caso, con el pelo hallado en el cinturón de Desirée Hernández, de unos 4 cm de longitud y cano, durante la autopsia de su cadáver.

)El pelo hallado, que según el folio 3735 del sumario se encuentra en el Instituto de Toxicología de Madrid deberá serle reclamado y puesto a disposición, a la mayor brevedad, de la Unidad Docente de Medicina Legal de la Universidad de Valencia, quien llevará a cabo los correspondientes estudios y análisis, conforme al programa y presupuesto elaborado.

 

3º)Deberá darse cuenta puntual y semanalmente a este Tribunal de las causa que en cada momento impidan la terminación de la instrucción, conforme a las previsiones del art.324.1 LECR.

SEGUNDO: Por no considerarse eficaz para el esclarecimiento de los hechos, y contrario al principio de prescripción de las dilaciones indebidas – en un procedimiento ya tan sumamente dilatado – no ha lugar a la práctica de los otros extremos de la pericial solicitada por la representación de los acusadores particulares Sres. García Mediano y Gómez Moreno dados los informes obrantes en autos, y en especial – fº3800 y ss – los elaborados por el Instituto Nacional de Toxicología.

Por todo ello,

VISTOS los arts. citados y demás de aplicación.

PARTE DISPOSITIVA

LA SALA ACUERDA, revocar el auto de conclusión del sumario dictado con fecha 16-2-96 por la, Sra. Juez de instrucción nº 6 de Alzira con objeto de que se lleven a cabo las diligencias antes expresadas y las demás que fueren estrictamente necesarias para el esclarecimiento de los hechos.Notifíquese a las representaciones de la acusación particular, de las acusaciones populares personadas, de la defensa del procesado y póngase en conocimiento del Ministerio Fiscal. Con testimonio de la presente resolución, devuélvanse las actuaciones originales al Juzgado de su procedencia, quedando en la Secretaría de este Tribunal las piezas de convicción que no resultaron necesarias para la práctica de las nuevas diligencias para su ejecución y cumplimiento.

Así por este su auto, lo acordaron y firman los Ilmos. Sres. anotados al margen, doy


Sobre la prueba de ADN

Sobre Miguel Nicolas Cortona se pidieron las siguientes pruebas:
Extracción de pelos de su cabeza y pubis para la práctica de la pericial consistente en la comparación del ADN. y características microscópicas y peculiares y de queratinas, en su caso, con el pelo hallado por el Dr. Frontela en el cinturón de Desirée Hernández, de unos 4 cms de longitud y cano, durante la autopsia de su cadáver.

Expliquemos un poco en que consisten estas pruebas:

Comparación de ADN mitocondrial y carácterísticas microscópicas y peculiares de queratinas

Posteriormente se le requeriría una muestra de sangre para completar el análisis de ADN mitocondrial, ya que no es suficiente solo con ambas muestras de pelo.

SUMARIO

FOLIO 3957

JUZGADO INSTRUCCIÓN Nº SEIS DE ALZIRA
COMPARECENCIA.– En Alzira a diecinueve de julio de mil novecientos noventa y seis.

Ante S.Sª, asistido de mi la Secretario, comparece el Médico Forense de este Juzgado DON JOSÉ FRANCISCO TAVERNER ESTALRICH, y comparece con objeto manifestar:

Que mediante comunicación telefónica mantenida con la Unidad de Medicina Legal de la Facultad de Medicina de Valencia, ha tenido conocimiento de que se precisa una nueva toma de muestras al imputad o Miguel Nicolás Cortona consistente en la extracción de una toma de sangre con la finalidad de complementar la prueba ya acordada.

Y encontrándola conforme la firma con SSª, doy fe.

FOLIO 3965

JUZGADO INSTRUCCIÓN Nº SEIS DE ALZIRA

COMPARECENCIA.– En Alzira a veinticuatro de julio de mil novecientos noventa y seis.

La extiendo yo el Secretario Sustituto para hacer constar que teniendo a mi presencia a DON MIGUEL NICOLÁS CORTONA con D.N.I. nº 19.XXX. le requiere a fin manifieste si voluntariamente accede a la práctica de la prueba interesada por este juzgado, en concreto a la extracción de sangre a fin poder completar la pericial de análisis comparativo y en este acto manifiesta: que no tiene ningún inconveniente. Y encontrándose presente su letrado, firman ambos en prueba de conformidad, doy fe.

FOLIO 3966

JUZGADO INSTRUCCIÓN Nº SEIS DE ALZIRA

DILIGENCIA.– En Alzira a veinticuatro de julio de mil novecientos noventa y seis.

La extiendo yo el Secretario Sustituto para hacer constar que en el día de la fecha se procede a la práctica de la prueba interesada por el juzgado por auto del pasado 19-7-96, en concreto a la extracción de sangre para llevar a cabo el análisis completo de ADN mitocondrial, encontrándose presentes en el Clínico Médico Forense de este Juzgado, el Médico Titular de este juzgado D. José Taverner Estarlrich, la Doctora Mercedes Aler Gay, el imputado D. Miguel Nicolás Cortona, el letrado del mismo D. Bernardo Mahiques Alonso, con mi asistencia la Secretario.

Se procede tras la toma de la muestra a su remisión a la Unidad Docente de Medicina Legal, Facultad de Valencia a través de la Doctora Dª. Mercedes Aler Gay.

Y encontrándola conforme la firman todos los presentes, de lo que doy fe.

Folios 3967 – Acuse de recibo de envío

FOLIOS 4102 – 4109

DEPARTAMENT DE MEDICINA PREVENTIVA I SALUT PÚBLICA, BROMATOLOGÍA, TOXICOLOGÍA I MEDICINA LEGAL UNITAT DOCENT DE MEDICINA LEGAL

Ilma. Sra.:

Adjunto remito el informe correspondiente al análisis realizado por esta Unidad Docente en la Sección de Biología Forense del Instituto de Medicina Legal de la Universidad de Santiago de Compostela, en cumplimiento de lo dispuesto en el Sumario 1/93- A de ese juzgado.

Valencia a 24 de octubre de 1.996 Fdo. Mª Gisbert – Profª. Titular

Ilma. Sra. Juez del Juzgado de 1º Instancia e Instrucción nº 6 de los de ALCIRA.

DEPARTAMENT DE MEDICINA PREVENTIVA I SALUT PÚBLICA BROMATOLOGÍA, TOXICOLOGÍA I MEDICINA LEGAL UNITAT DOCENT DE MEDICINA LEGAL

Sección Biología Forense

 

INFORME DE ANÁLISIS 1C96/V

Por esta Unidad Docente se ha llevado a cabo, utilizando la metodología y el apoyo técnico y científico del Instituto de Medicina Legal Santiago de Compostela, el análisis solicitado por el juzgado de Instrucción nº 6 de Alcira, en relación con el Sumario l/93-A. que se instruye en ese Juzgado, según las especificaciones siguientes:

ANÁLISIS SOLICITADO:

Se solicitó a este Centro … “análisis comparativo del ADN. mitocondrial características microscópicas y peculiares y de queratinas… entre el pelo hallado en el cinturón de la fallecida Desirée Hernández y los pelos de cabeza…así como de la muestra de sangre de D. Miguel Nicolás Cortona.

– MUESTRAS UTILIZADAS:

2.1.-Muestra número 1:

Paquete entregado en esta Unidad Docente por la Empresa de transportes DIAPACK. envuelto en papel de color marrón. con una etiqueta de color blanco, cuya fotocopia se adjunta. Unido al mismo con cinta ,adhesiva, se encuentra un sobre del Instituto Nacional de Toxicología en el anterior del cual hay un oficio cuya fotocopia asimismo se adjunta. Se procede a retirar la envoltura y se encuentra una caja de color blanco con la referencia nº 346/93. Al abrir la caja hay una bolsa de plástico que contiene un portaobjetos envuelto en papel blanco en el que se lee “346/93 Cadáver-2, M-7. 1. Cinturón”

Sobre el portaobjetos están escritos los siguientes datos “Cadáver 2, 346/93, Cinturón 1″: sobre aquél y unido a sus extremos con cinta adhesiva un cubreobjetos y entre ambos se encuentra un pelo de color blanco y de unos 40 milímetros de longitud. Se adjunta fotografía del mismo (Foto 1)

2.2.-Muestra número 2:

Paquete de color marrón que fue entregado en esta Unidad Docente por el Médico Forense del Juzgado de 1ª Instancia e Instrucción núm. 6 de los de Alcira, con el cuño del referido Juzgado, Quitada la envoltura y en el interior de una caja de color blanco se encuentran dos recipientes herméticos con las inscripciones “PELOS PUBIS” en el primero y “PELOS CABEZA” en el segundo. Ambos contienen pelos en su interior. Se adjunta fotografía de los mismos, (Foto núm.2)

2.3.-Muestra número 3:

Sangre extraída por venipunción, previo consentimiento informado, a Miguel Nicolás Cortona,

-MÉTODO:

Dado el escaso tamaño de la muestra número 1 se decidió realizar el análisis del ADN mitocondrial (mtDNA) por ser mucho más informativo que los análisis de queratinas.

3.1.- División de la muestra.

El cabello que constituye la muestra nº 1 fue dividida en dos mitades de 2 cm. cada una de las cuales fue procesada por un equipo independiente, usando en ambos casos la misma metodolog1a que se describe a continuación.

Las muestras nº 2 y nº 3, asimismo fueron divididas en dos partes. Cada una de las cuales fue procesada. también de forma independiente, por cada uno de los dos equipos ya mencionados,

3.2.- Extracción de ADN mitocondrial:

Se ha empleado una resina de intercambio iónico. para el proceso de extracción de las tres muestras, según protocolo descrito por Walsh (1)

Referencia: (1) Walsh PS, Metzger DA, Higuchi R (1991): Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material Biotechniques, 10(4):506-513.

3.3.- Amplificación por PCR de la región control:

Se han empleado los iniciadores (primers) descritos a continuación, realizando el protocolo de amplificación según las referencias señaladas(3.4)

El producto amplificado obtenido se ha chequeado en minigeles de poliacrilamida con gradiente de concentración con posterior visualización mediante Unción argéntica, según el protocolo descrito por Barros (5), asimismo se han empleado controles negativos y positivos en cada análisis realizado .

Primers Región control:

L15997F 5’CACCATTAGCACCCAAAGCT3′

H408 5’CTGTTAAAAGTGCATACCGCCA3′

Referencias:

2.-Hopgood R, Sullivan KM. Gill P (1992): Strategies for automated Sequencing of Human Mitocondrial DNA directly from PCR producís Biotechniques 14(1.): 82-92.

3-Sul1ivan KIVI. Hopgood R y Gill P (1992) Identification of human remains by amplification and automated sequencing of mitocondria.1 DN A.Int J. Legal Med. 105:83-86

4.- Wilson MR DiZinno JA, Polanskey D. Reploge J. Budowle B( 1995) Validation of mitocholldrial DNA sequencing for forensic casework analysis. Int. J. Legal Med, 108:68-74.

5.- Barros F; Lareu MV y Carracedo A(1992) Detection of polymorphisms of human DNA after PCR by miniaturized SDS- polyacrylamide gel electrophoresis, For Sci Int, 55:27—36

3.4.- Nested-PCR de las regiones hipervariables HV1 y HV2:

Se ha realizado la amplificación de la región control para las zonas hipervariables HV1 y HV2, empleando los iniciadores descritos a continuación, y siguiendo el protocolo descrito en las referencias (3) con pequeñas modificaciones. También en este caso se han empleado controles negativos y positivos.

3.).- Secuenciación cíclica mediante secuenciador automático (ALF-Pharmacia, Uppsala, Suecia),

Se han secuenciado todas las muestras, tanto para la zona hipervariable 1 (HV1) como para la 2 (HV2), siguiendo el protocolo empleado por el Instituto de Medicina Legal de Santiago de Compostela -Sección de Biología Forense-, basado en eel trabajo de Wilson (6), Todas las secuencias fueron repetidas al menos 2 veces por cada grupo independientemente, sin discrepancias analíticas entre los dos grupos,

Referencia: 6.- Wilson MR. Polanskey D. But1er J, Dizinno JA. Replogle J y Budowle B ( 1995): Extraction, PCR amplification and sequencing of mitochondrial DNA from human hair shafts. Biotechniques. 18(4):662-668.

CONCLUSIONES

La muestra de la cana posee una secuencia en ADN mitocondrial diferente a la secuencia de Miguel Nicolás Cortona, con cuatro discrepancias en la región HV1 y seis discrepancias en la región HV2, por lo que podemos afirmar con total seguridad que la muestra de cabello no pertenece a Miguel Nicolás Cortona.

 

Nota: La muestra de cabello fue agotada íntegramente en el análisis. Existen muestras congeladas de producto extraído y de producto amplificado que serán conservadas durante 2 años salvo petición en contrario.

Valencia, a 21 de octubre de 1996

Fdo. Mercedes Aler Gay Fdo. Marina S. Gisbert Grifo


pelo-cano

Los resultados de los análisis confirmaron que el pelo cano hallado en el cinturón de Desirée no pertenecía a Miguel Nicolás Cortona.

La muestra de  cabello fue agotada durante la ejecución de la prueba, pero parte del producto extraído de esta muestra fue congelado y conservado para posteriores pruebas en el caso de requerirse. Nunca se requirió.  Así que el 21 de octubre de 1998 la muestra fue destruida y el pelo cano nunca podrá ser comparado de nuevo.

Siempre quedará la pregunta sin respuesta: ¿A quién pertenecía el pelo cano? Nunca lo sabremos.

boton-volver3

comentarios
  1. […] El pelo cano y el análisis de ADN […]

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s