Frontela rollos de sala

Resumen de diligencias de los rollos de sala del caso en las que interviene el Profesor Frontela



 

FOLIOS 34-35
A LA SECCIÓN SEGUNDA DE LA ILMA. AUDIENCIA
PROVINCIAL
HIGINIO RECUENCO GÓMEZ, Procurador de los Tribunales y de D. FERNANDO GARCÍA MEDIANO y otros, cuya representación tengo acreditada en el Sumario nº 1/93 del Juzgado de Primera Instancia e Instrucción numero SEIS de Alcira, ante la Sala comparezco y, como mejor proceda en Derecho, DIGO:
Que cumpliendo el trámite de instrucción, según Providencia de fecha 12 del presente mes, notificada a esta parte el mismo día, manifiesto mi DISCONFORMIDAD con el auto de conclusión del sumario, y solícito LA REVOCACIÓN del mismo, en base a las siguientes,
ALEGACIONES
PRIMERA.-
Después de aportada la “prueba pericial” de esta “acusación particular”, en la que se habla de “hallazgos de nuevos elementos de identificación que podrían pertenecer a cuatro personas distintas” (así referido por el Profesor Frontela Carreras), con el fin de establecer la posibilidad de abrir una nueva línea de investigación, o de ratificar la existente sobre participación de los actuales procesados y posibilidad de que otras personas pudieran haber intervenido en los hechos origen de la causa, por esta parte se interesa, en escrito de fecha 18 de octubre pasado, la practica de una serie de pruebas periciales que, en base a las “pruebas indubitadas” remitidas en su día al Instituto Nacional de Toxicología, pudieran llevar a una identificación de dichos “nuevos hallazgos”, lo que permitiría obtener nuevos elementos de incriminación a los ya procesados o incriminar a “nuevos terceros intervinientes”.
SEGUNDA.-
Por el Instructor, compartiendo los criterios por los que se interesan, se admiten dichas diligencias interesadas y se acuerda lo pertinente para su practica.
Ello confirma la opinión de esta parte de la utilidad, pertinencia, conveniencia o necesidad de la practica de dichas pruebas para el buen fin de la instrucción sumarial.
TERCERA.-
Requerido al efecto el Instituto Nacional de Toxicología, contesto: “no poder remitir pelos de … por la escasa cantidad de los mismos” de algunos de los relacionados, mientras que respecto de otros se decía carecer de muestras, pese a constar en el procedimiento el acuse de recibo de dichas muestras.
Si las pruebas son convenientes no es justificación, para la no practica de una prueba, ni el “no poder remitir pelos de … por la escasa cantidad de los mismos”, si no se pueden remitir los pelos deben arbitrarse los procedimientos necesarios para que la practica de la prueba se lleve a cabo, ni tampoco lo es la “excesiva duración de la causa”.
CUARTA.-
Esta parte, al igual que el resto de las personadas en el presente procedimiento, está igualmente interesada en la rápida conclusión del procedimiento pero llevando a juicio no sólo a aquellas personas que ya están procesadas sino también a aquellas otras de las que pudiera derivarse responsabilidad. Teniendo en cuenta que, según los informes facilitados, las practica de dichas pruebas no necesitaría un plazo superior a un mes, una vez se remitiera lo interesado a los peritos de esta parte, no debería haberse declarado concluso el sumario, sino que por las propias razones por las que se
admitieron, haber acordado, conforme interesamos en nuestro escrito de fecha 1 5 de noviembre pasado, la practica de dichas pruebas.
No habiéndole hecho así, y siendo conveniente para el buen fin de la instrucción, debe revocarse el auto de conclusión del sumario y remitirse al
Juzgado de Instrucción, ordenando acuerde lo necesario para la practica de la prueba propuesta para esta parte y admitida en su día.
En si virtud,
SUPLICO A LA SALA que teniendo por presentado este escrito, con sus copias, se sirva admitirlo, tener por evacuado el trámite de instrucción; por hechas las anteriores manifestaciones y, en virtud de las mismas, acordar la revocación del auto de conclusión del sumario y su remisión al Juzgado de Instrucción, ordenando lo conducente para la practica de las pruebas referenciadas en el cuerpo de este escrito.
Valencia a Catorce de diciembre de mil novecientos noventa y cuatro.
Fdo. Luis M. ROMERO VILLAFRANCA; Fdo. Higinio RECUENCO GÓMEZ

 

FOLIOS 45-46
A LA SALA
JUAN ANTONIO RUIZ MARTÍN Procurador de los Tribunales, en nombre de la Asociación Clara Campoamor, cuya representación ya consta debidamente acreditada en el Sumario 1/93 del Juzgado de Instrucción número Seis de Alcira, ante la Sala comparezco y como mejor en derecho proceda,

DIGO:
Que evacuando el trámite de instrucción vengo mediante el presente escrito a solicitar con base procesal en el artículo 627 LECrim. la revocación del Sumario, según los siguientes,
FUNDAMENTOS

PRIMERO.- Nos adherimos a los motivos esgrimidos por la acusación particular que se ha pronunciado en el mismo sentido, haciendo nuestras las pruebas solicitadas para su práctica que aconsejan la revocación.

SEGUNDO.- Refuerza la petición de revocación el mismo informe enviado por el Instituto Nacional de Toxicología de 31 de Octubre por el que después de dar cuenta de la escasa cantidad de pelos que poseen de Roberto Anglés Martíns, Miguel Ricart Tárrega y Luis Rivera Gallardo, añaden “estamos pendientes de la investigación de ADN, llevada a cabo en las raíces de los pelos para emitir los informes correspondientes, por lo que no nos es posible enviar los pelos solicitados de estas tres personas”. De lo que se sigue, que la investigación no se halla finalizada, y por tanto la instrucción no debe darse por concluida.
El instructor aunque no ha tenido en cuenta este extremo, se infiere de su Auto de Conclusión que le hubiera resultado igualmente irrelevante porque Joaquín Mauricio Anglés es jurisdiccionalmente dependiente de un Juzgado de Menores, de Miguel Ricart se dispone de otros elementos que permiten dirigir la acusación contra el mismo, y del resto no hay indicios en la investigación que acrediten la necesidad de la extracción voluntaria de pelos que permitan su análisis genético.
Si bien es cierto que Joaquín Mauricio Anglés cuando sucedieron los hechos era menor de edad, y no puede resultar inculpado en este procedimiento, ello no obsta a que su participación o no, sea esclarecida en la presente Causa, entre otras cosas porque de ello se puede derivar una ulterior inculpación para otras personas, o la confirmación o desmentido de las versiones que obran en el Sumario, es por esto que Joaquín Mauricio Anglés pese a que no puede ser inculpado en este procedimiento ha sido citado al mismo y con asistencia de Letrado. De Miguel Ricart señala el Instructor que existen suficientes datos para dirigir la acusación, pero además de la obtención de la verdad material hasta donde sea posible, se requiere agotar la instrucción desde la perspectiva de las acusaciones no sólo para acusar, sino para demostrar de manera cierta la participación en los hechos. Esto es, para acreditar no la existencia de indicios (acusación), sino su participación a título de autor (sentencia condenatoria).
Del resto, Ramón Antonio Losa Raga, José Miguel Martínez Cana y Luis Rivera Gallardo, se señala que en la instrucción no existen indicios, sin embargo, hay que recordar que la detención de Miguel Ricart se produjo a raíz de comprobarse que era un sujeto del entorno de Antonio Anglés, y no porque se tuviesen datos sobre su participación, es más, inicialmente fue descartado.
Los antes referidos pertenecen todos a ese entorno, hasta el extremo que casi puede decirse que vivían en el mismo domicilio que Antonio Anglés.

TERCERO.- Antes, se ha dicho que por el propio Instituto Nacional de Toxicología no se han analizado los pelos de los que disponen, a los que habría que añadir los hallados por el profesor Frontela, por lo que procede ahora reseñar la importante cantidad de pelos hallados y remitidos a dicho Instituto:

1) Folio 121 del Atestado.- Muestra 11-F: Pelos recogidos en el interior de la fosa.
2)Folio 126 y 127 del Atestado.- Pelos recogidos en el interior de la caseta (buhardilla). Muestra 1-S: Pelos recogidos en el colchón tipo Flex.
Muestra 2- S: Pelos recogidos en el colch6n Flex. Muestra 22-S: Pelos recogidos sobre el colchón de espuma.
3)Folio 130 y 131 Atestado.- Pelos obtenidos del Opel Corsa.

Muestra UNO (en el tapizado), DOS (paso de rueda izquierdo trasero), TRES (paso de rueda derecho trasero), CUATRO (asiento trasero abatible), CINCO (en la misma zona que la anterior), SEIS (bajo el asiento posterior abatible), SIETE (parte delantera del asiento trasero), OCHO (tapizado del maletero), NUEVE (bandeja del maletero), DIEZ (respaldo del asiento trasero), ONCE (envase de bengalas), DOCE (debajo del asiento del conductor), TRECE (debajo asiento del ocupante delantero), CATORCE (cepillo color rojo).

4) Folio 137 atestado. Muestra UNO (guantera), TRES (palo de madera), CUATRO (maletero), CINCO (maletero), SIETE (asiento trasero), OCHO (bandeja del maletero), NUEVE (asiento delantero derecho), DIEZ (asiento conductor).
La recepción de todos estos pelos se contiene en el “Acuse de recibo” del Instituto Nacional de Toxicología obrante al folio 724 de la Causa, y hasta el momento no se ha recibido informe alguno sobre marcadores genéricos de dichos pelos.

CUARTO.- En la declaración de Joaquín Mauricio Anglés, se tuvo conocimiento por primera vez que la fosa había sido cavada con anterioridad para ocultar una moto, circunstancia ésta que cuadra con el hallazgo en dicha fosa de pegatinas identificativas de una moto que fue localizada en la caseta de Turís que había sido sustraída, al parecer, por Antonio Anglés. Participó, según Mauricio, para cavar la fosa, su hermano Ricardo. De este modo resulta necesaria la declaración de Ricardo Anglés sobre esta cuestión para determinar cuando se cavó, quién, si posteriormente se tapó, y con qué fin.
En su virtud,
SUPLICO A LA SALA, que habiendo por recibido el presente escrito, se digne admitirlo, tenga por evacuado el trámite de instrucción y por instada la revocación del sumario, para la práctica de las pruebas que anteceden.

FOLIOS 60-61
AUDIENCIA PROVINCIAL – SECCIÓN SEGUNDA – VALENCIA SUMARIO 1-93 – ALZIRA-6
AUTO
Ilmos. Sres. Presidente: D. FRANCISCO MONTERDE FERRER
Magistrados: D. MARIANO TOMAS BENÍTEZ y Dª. CARMEN LLOMBART PÉREZ
En VALENCIA, a 19 de Enero de 1995.
HECHOS
ÚNICO.- Declarado concluso por el Juzgado Instructor Nº 6 de Alzira el sumario 1/93 seguido por los delitos de rapto, violación, asesinato, inhumación ilegal y tenencia ilícita de armas por los que se encuentra procesado Miguel Ricart Tárrega, y remitido que fue en su día a este Tribunal, se pasaron los autos para instrucción a las partes, interesando las acusaciones particular y popular la revocación del auto de conclusión del sumario para la práctica de determinadas diligencias.

RAZONAMIENTOS JURÍDICOS
ÚNICO.- Dada las peticiones efectuadas por las partes acusadoras particular y popular, no pudiéndose entender completa la instrucción sumarial atendida la pendencia de informe sobre ADN de pelos por parte del Instituto Nacional de Toxicología -fº 2829- referente a Roberto Anglés, Miguel Ricart Tárrega y Luis Rivera Gallardo, y la conveniencia para el esclarecimiento de los hechos de que se realice el análisis interesado respecto de Joaquín Mauricio Anglés, Ramón Antonio Losa y José Miguel Martínez Cana, y la declaración de Ricardo Anglés con relación a la fosa de la motocicleta, es procedente decretar la revocación del auto de conclusión del sumario conforme a las previsiones del art. 631 de la LECRM., expresándose las diligencias que han de practicarse.
Por ello, VISTOS el artículo citado y demás de aplicación,
PARTE DISPOSITIVA: LA SALA ACUERDA revocar el auto de conclusión del sumario acordado por el instructor en fecha 15-11-94, con objeto de que se practiquen las diligencias, interesadas por las partes acusadoras, siguientes:
1)Declaración de Ricardo Anglés sobre la fosa en la que primitivamente se ocultó una motocicleta.
2)Emisión por el Instituto Nacional de Toxicología de los informes pendientes sobre ADN relativos a pelos procedentes de Roberto Anglés, Miguel Ricart Tárrega y Luis Rivera Gallardo.
3)Acabada esta diligencia, envío por el Instituto Nacional de Toxicología de las muestras indubitadas de los referidos, al Profesor Frontela de Sevilla para la realización de los análisis con relación a las muestras que ya obran en su poder.
4) Que se tomen muestras de pelo o vello, tal como las partes soliciten para su remisión al Profesor Frontela, de Joaquín Mauricio Anglés, Ramón Antonio Losa Raga, y José Miguel Martínez Cana. Y las demás que se derivaren.
Así lo acordaron, mandaron y firmaron los señores arriba expresados, de que certifico.
Diligencia.- Seguidamente se cumple, certifico.

FOLIO 85
JUZGADO INSTRUCCIÓN NUMERO SEIS ALZIRA
Ilmo. Sr.
En virtud del procedimiento de este juzgado SUMARIO 1 del 93-A por delitos de asesinatos y otros contra MIGUEL RICART TÁRREGA Y ANTONIO ANGLÉS MARTÍNS, dirijo a VI el presente con objeto comunicarle de las causas que impiden su conclusión: se encuentra pendiente de solicitud de cooperación judicial a Catarroja con objeto tomar declaración en calidad de testigo a RICARDO ANGLÉS MARTÍNS y asimismo, se encuentra pendiente de que el Instituto Nacional de Toxicología remita informe pendiente sobre el ADN relativos a ROBERTO ANGLÉS; MIGUEL RICART TÁRREGA Y LUIS RIVERA GALLARDO y asimismo pendiente de recibir acuse de la remisión por parte del Instituto Nacional de Toxicología de las muestras de pelo o vello de Joaquín Mauricio Anglés, Ramón Antonio Losa Raga y José Miguel Martínez Cana al profesor Frontela.
En Alzira a 17 de febrero de 1.995.
EL JUEZ INSTRUCTOR.
AUDIENCIA PROVINCIAL DE VALENCIA – SECCIÓN SEGUNDA

FOLIO 86
JUZGADO INSTRUCCIÓN NUMERO SEIS ALZIRA
Ilmo. Sr
En virtud del procedimiento de este juzgado SUMARIO 1 del 93-A por delitos de asesinatos Y otros contra MIGUEL RICART TÁRREGA Y ANTONIO ANGLÉS MARTÍNS, dirijo a VI el presente con objeto comunicarle las causas que impiden su conclusión:
Se encuentra pendiente de solicitud de cooperación judicial remitida a Catarroja con objeto recibir declaración a RICARDO ANGLÉS MARTÍNS y así mismo se encuentre pendiente de que el Instituto Nacional de Toxicología remita informe pendiente sobre ADN sobre ROBERTO ANGLÉS y otros y que reciba acuse de recibo o remisión por parte Instituto mencionado de las muestras de pelo o vello de Joaquín Mauricio Anglés y otros, a disposición del Profesor D. Frontela.
En Alzira a 24 de Febrero de 1.995.
EL JUEZ INSTRUCTOR
AUDIENCIA PROVINCIAL DE VALENCIA – SECCIÓN SEGUNDA

FOLIOS 169- 171
A LA SALA JUAN ANTONIO RUIZ MARTÍN, Procurador de los Tribunales, en nombre de la Asociación Clara Campoamor, cuya representación ya consta debidamente acreditada en el Sumario 1193 de¡ Juzgado de Instrucción número Seis de Alcira, ante la Sala comparezco y como mejor en derecho proceda, DIGO:
Que evacuando el trámite de instrucción vengo mediante el presente escrito a solicitar con base procesal en el articulo 627 L.E.Crim. la revocación del Sumario, según los siguientes
FUNDAMENTOS
PRIMERO.- Antes que nada, es preciso señalar que la revocación que se solicita debe ponderarse a la vista de los derechos en conflicto. De una parte la obtención de la verdad material en cuanto realización de la Justicia (art. 1 CE) y de otra el derecho a un proceso sin dilaciones indebidas (art. 24.2 CE). Para coadyuvar a la resolución del “balancing”, a continuación se expondrán elementos contradictorios a valorar por el Tribunal. En definitiva el “balancing” pertenece a la función jurisdiccional. Pero ahora, conviene saber que la dilación en el procedimiento que no haya producido indefensión, no haya desvirtuado el material probatorio o no haya causado perturbación grave en el procesado no vulnera lo que se ha conocido en la “review law” como “speedy trial”. No obstante, se ha de tener presente que un proceso sin dilaciones indebidas forma parte de un proceso justo, de modo que justicia e interdicción de dilaciones indebidas no sólo no están enfrentados sino que forman parte del mismo concepto y derecho, de modo que un proceso tardío es contrario a la prevención general- la respuesta pena¡ no es adecuada, y a la prevención especial ,es perturbadora sino innecesaria. Ahora bien, el proceso no puede estar comprometido por un plazo determinado, si lo ha de estar por uno razonable, pero no por uno concreto. Armonizar las exigencias de la investigación con la tutela jurídica requiere que el proceso se desenvuelva con celeridad, pero también, y sobre todo, preservando las garantías de las partes ,verdadero núcleo del proceso. Y esta preservación se materializa en los actos de investigación propuestos por las mismas, o de oficio, que sean necesarios, pertinentes y útiles.
SEGUNDO.- Sentado lo anterior, de inmediato se detecta una insuficiente, sino deficiente instrucción, que no obstante habrá de valorarse desde el prisma de la necesidad y de la utilidad.
a) Del informe del Instituto de Toxicología BCHQ-345.346 y 347/93 de 7 de Julio de 1.995, corregido por el posterior de 30 de Agosto del mismo año, BCHQ-0345.0346 y 0347/93, se concluye (Hoja nº XVI.2) que de las 165 muestras de pelos recogidos en los Seat Ronda y Corsa y sobre dos colchones sólo se han detectado cantidades límites de ADN humano en 7 pelos (muestras contenidas en la hoja nº XI), sin embargo las conclusiones que se obtienen versan sobre seis pelos, M12.24, M13.2, C5.15, C7.3,4 5 C8.5 y 1.S.2.
Ninguna referencia se ofrece sobre el pelo M12.12. Aún así, pudiera pensarse que es intrascendente su análisis porque fue localizado en el Opel Corsa, y en dicho vehículo, pudieron viajar diversas personas sin ninguna relación con los hechos. No obstante, conviene considerar que el Opel Corsa fue el vehículo que se utilizó para trasladar a las niñas hasta el paraje de la Romana, y la presencia de un pelo de persona distinta a los que son objeto de investigación es un dato complementario en la valoración global de los hechos y de sus autores.
b) Las muestras analizadas por el Instituto de Toxicología para la detección de polimorfismos de ADN en restos de semen, se han utilizado como muestras de sangre indubitadas la de Neusa Martíns Días, Miguel Ricart Tárrega, y Joaquín Mauricio Anglés Martíns. Y las de pelos de Roberto Anglés Martíns, Enrique Anglés Martíns y Luis Ribera Gallardo. Pues bien, no se han analizado dos muestras más que el Instituto de Toxicología disponía: los pelos de la cabeza y pubis de Ramón Antonio Losa Raga y José Miguel Martínez Cana,, el primero autor de la sustracción de la pistola Star a un Policía local de Benetuser que luego cambió por una más pequeña a Antonio Anglés, y el segundo identificado como el “Nano” inculpado por Miguel Ricart, residente en Catarroja y amigo de Antonio Anglés con quien también coincidió en prisión.
La disponibilidad de estas muestras pese a no constar – que se haya podido verificar- acta de recepción se infiere de: a’) las Diligencias de remisión que constan en los Atestados 278193 y 280/93 de la Guardia Civil que obran en las actuaciones; y b’) del escrito de recepción del Dr. Frontela de 15 de Mayo de 1.995, que reconoce haber recibido del Instituto de Toxicología “pelos de cabeza y pubis de Joaquín Mauricio Anglés, Ramón Antonio Losa Raga y José Miguel Martínez Cana, pese a que en el acta de remisión del Instituto de Toxicología de 18 de Abril de 1.995 no constan..
También la ausencia de las muestras y su consiguiente análisis es cuestionable, porque la muestra dubitada es de la funda de un colchón encontrado en la caseta del paraje de la Romana, y la presencia de restos de semen no necesariamente tienen que tener relación con los hechos, y además tales restos se identifican con un hijo de Neusa Martíns, pero no proveniente ni de Joaquín Mauricio, Roberto, y Enrique Anglés Martíns. Distinto es, sin embargo, en lo relativo a los restos de sangre encontrado y a los pelos utilizados como muestra dubitada.
c) Lo mismo cabe reproducir en el informe emitido por el Dr. Frontela en quince de Diciembre de 1.995, pero aquí resulta aún más sorprendente, porque: a’)Existe acta de recepción de los pelos de Ramón Antonio Losa Raga y José Miguel Martínez Cana; b’) Los pelos sospechosos, examinados, sin embargo, se limitan a los de Enrique Anglés (cabello y pubis), Miguel Ricart Tárrega (pubis), Luis Rivera Gallardo (pubis) y Roberto Anglés (pubis), se ignoran, por tanto, los de Joaquín Mauricio Anglés y los de Losa Raga y Martínez Cana; c’) y todo ello resulta aun más extraño, cuando en las conclusiones se identifica a un pelo de Miguel Tárrega y a “los denominados sujetos D y F, que no corresponden con pelos sospechosos que no nos han sido enviados. Además hay otros tres pelos aislados, no catalogados”, llegan a afirmar. Los que corresponden al sujeto D son tres cabellos hallados en el jersey de Antonia Gómez; los de¡ sujeto F son tres cabellos hallados también en el jersey de Antonia y uno en el sostén de Desirée Hernández. Y luego hay un sujeto J (pelo de cabeza hallado en la ropa de Desirée), y un sujeto G (una cana de cabeza hallado en la ropa de Desirée).
La prueba del Dr. Frontela tiene un plus y un minus a valorar.
De una parte, es trascendente porque versa sobre cabellos hallados en el cuerpo o ropas de las víctimas, de modo que la identificación de cabellos, comporta la identificación de los autores, porque significa ellos que estuvieron en contacto con las niñas. De otra, sin embargo, su análisis, al desechar el DNA mitocondrial, consiste en un estudio de las características microscópicas y peculiares, del que desconocemos los datos de probabilidad, sin perjuicio de que se puedan concretar cuando finalicen los análisis de queratinas que aún no han finalizado (Conclusión Cuarta y Quinta)
Junto a lo expuesto, existe un dato, a nuestro juicio de la mayor relevancia, que había pasado desapercibido y que requiere una detenida valoración. En el informe de autopsia practicado por el Dr. Frontela de 26 de Agosto de 1.994 se informaba al folio 170 del hallazgo de un pelo en el cinturón del pantalón de Desirée Hernández, de unos 4 cm, perteneciente a la cabeza, y de color 0/5 cana. En el informe de cotejo de pelos de quince de diciembre de 1.995, en sus folios 96, 100, 104, 108, 112, 116, 120, 124, 128, 132, 136, se contienen los cuadros comparativos con las muestras indubitadas, describiendo el cabello como el hallado en el cinturón de Desirée, perteneciente a la cabeza de un individuo, con forma de cola de ratón y color albino, lo que hace que no se catalogue porque “ignoramos si entre ellos puede haber algunos canosos o albinos”.
Pues bien, en el entorno conocido de Antonio Anglés y Miguel Ricart, todos son jóvenes y morenos o castaños, a excepción de uno que ha declarado en las actuaciones y sobre el que no se ha practicado ninguna prueba complementaria, ni siquiera la ratificación de su declaración a presencia judicial. En efecto, al folio 300 consta la declaración ante la Guardia Civil de Miguel Nicolás Cortona, nacido en Valencia el 4 de Abril de 1.942, en el momento de los hechos tenía por tanto 51 años), conocido como “Miguel el de Liria”, que estuvo viviendo una temporada en casa de los Anglés en Catarroja, una temporada, y Antonio Anglés en una caseta de su propiedad sita entre Liria y Pedralba, parcela D-26. Que conoció al Rubio”, Miguel Ricart en la cárcel compartiendo celda. Que Mauricio Anglés declaró el 27 de Octubre de 1.994: “Que en las navidades de 1.992, recuerda que un día yendo hacia Lliria, el declarante, Miguel Ricart, con su hermano Antonio y con Miguel el de Lliria, Antonio y Ricart, comentaron que podían coger unas chavalas y tenerlas unos días para pasarlo bien y violarlas, pero el declarante y Miguel el de Lliria les hicieron ver que eso era una aberración”. Todas estas circunstancias aconsejan también una investigación ampliatorio con respecto al sospechoso porque reúne las características que le hacen merecedor de ser objeto de investigación. Bien es cierto que declara que salió de la cárcel el 14 de diciembre de 1.992, pero se desconoce si ello corresponde a la realidad, y de otra parte, cuando ingreso en la misma, en calidad de preventivo o de condenado, y si fuese en este último caso, si se benefició de permisos.
En su virtud,
SUPLICO A LA SALA, que habiendo por recibido el presente escrito, se digne admitirlo y tenga por instada la revocación del Sumario para la práctica de las pruebas instructoras de cotejo de muestras indubitadas de pelos de cabeza y pubis, por el Instituto de Toxicología y por El Dr. Frontela, de Ramón Antonio Losa Raga, José Miguel Martínez Cana y Miguel Nicolás Cortona, y además sobre este último, se oficie a la Dirección General de Instituciones Penitenciarias para que informe si durante el años 1.992 estuvo internado en alguna prisión, en calidad de qué, y si disfrutó de algún permiso, condiciones y fechas, y una vez recabados dichos datos, junto el resultado de los informes periciales solicitados sea citado a declarar,
Valencia, a 1 de Febrero de l.,996
Fdo. Virgilio Latorre. Fdo. Juan A. Ruiz

FOLIOS 274-277
AUDIENCIA PROVINCIAL VALENCIA – Sección Segunda
SUMARIO 1/93 – Juzgado Inst. Alzira 6.
AUTO
Ilmos. Señores: Don Francisco Monterde Ferrer, Don Mariano Tomás Benítez y Dª. Carmen Llombart Pérez
En la ciudad de Valencia, a dieciséis de febrero de mil novecientos noventa y seis.
Dada cuenta; y concurriendo los siguientes
HECHOS
PRIMERO.-Con fecha 3 de enero de 1996 por el Juzgado de Instrucción nº 6 de Alzira fue declarado concluso el Sumario 1/93,seguido por los delitos de Rapto, Violación, Asesinato, Inhumación Ilegal y Tenencia Ilícita de Armas por los que se encuentra procesado y en situación de prisión provisional desde el 31-1-93(prorrogada en 18-1-95) MIGUEL RICART TÁRREGA ,elevándose el sumario y las piezas de convicción.
SEGUNDO: Conferido el trámite de instrucción a las partes comparecidas, el procurador D. Juan Antonio Ruiz Martín en nombre de la acusadora popular Asociación Clara Campoamor, en 9-2-96,instó la revocación del sumario con objeto de que se practicaran las siguientes diligencias y por el siguiente orden:
1º) Oficio a la Dirección General de Instituciones Penitenciarias para que certifique sobre MIGUEL NICOLÁS CORTONA los siguientes extremos:
a) Si durante el año 1992 estuvo internado en algún centro penitenciario.
b) Si lo estuvo que se indique el periodo o periodos, en el caso de que hubiere ingresado en varias ocasiones.
c) Si estaba en calidad de penado, se informe sobre los permisos que se le concedieron y disfrutó, o bien sobre el grado penitenciario y si el régimen era de carácter abierto, señalando expresamente tanto para los permisos como para el cumplimiento en régimen abierto la fecha de inicio y de finalización y sus horarios.
2º) De encontrarse en prisión, sin régimen abierto, y sin permiso en el período comprendido entre el día 13 al 20 de noviembre de 1992, se renuncia al resto de las pruebas propuestas Por el contrario d encontrarse en prisión se solicita que sea citado a declarar en concepto de imputado, se solicite la extracción de pelos de la cabeza y del pubis para la práctica de la pericial que ha de versar no sólo sobre los pelos de Miguel Nicolás Cortona, sino también sobre los pelos que no han sido examinados hasta ahora de Ramón Antonio Losa Raga y José Miguel Martínez Cana.
La pericial consistirá en la comparación de las características microscópicas y peculiares junto al análisis de queratinas, dado que los pelos dubitados carecen de restos suficientes para la identificación de ADN.
Debiéndose realizar su práctica para observar la mayor diligencia, en un centro de Valencia, bien la Clínica forense, bien la unidad de Medicina legal de la Universidad de Valencia o el Centro de Investigación Grisolía de esta capital.
TERCERO: EL Procurador D. Francisco García Albert en representación de la defensa del procesado Miguel Ricart Tárrega en 15-2-96, manifestó:
A) que no había podido proponer determinadas pruebas dada la imposibilidad de comunicación con su defendido interno en el Centro de Herrera de la Mancha en la provincia de Ciudad Real, tras haberse denegado por la instructora su traslado al Centro Penitenciario de Castellón.
B)Que recientemente su defendido le había solicitado que se llamase a declarar a determinadas personas que podrían esclarecer los hechos, por lo que entiende necesaria la revocación del sumario.
C)Que se adhiere a la petición de la Asociación Clara de Campoamor en base a la necesidad de esclarecer autorías.
Y siendo de aplicación los siguientes
RAZONAMIENTOS JURÍDICOS
PRIMERO: Dadas las peticiones de revocación del auto de conclusión del sumario efectuadas por una de las acusaciones populares, y por la defensa del acusado a quien se dio el trámite del art. 627 de la LECR efectuando una interpretación integradora del mismo, de conformidad con los arts. 24 CE.,5.1 y 7.2 de la LOPJ. con objeto de garantizar el equilibrio procesal entre las partes en la fase intermedia, según ha indicado el TC. en sentencias como la de 22~3-85 6 17~4-89- habiendo informado 14, Subdirecci6n General de Gestión Penitenciaria que Miguel Nicolás Cortona estuvo preso exclusivamente entre el 27 de noviembre y el 14 de diciembre de 1992, no puede entenderse completa la instrucción sumarial, y se accede a la revocación de su conclusión, con objeto de que a la mayor brevedad, y teniéndose en cuenta las limitaciones temporales impuestas por la prisión preventiva del procesado, selleven a cabo las siguientes diligencias de entre las solicitadas:
1º) Se constate la realidad de la información sobre la prisión de Nicolás Cortona.
2º) De confirmarse lo anterior que sea citado a declarar en concepto de imputado MIGUEL NICOLÁS CORTONA, solicitándose la extracción de pelos de su cabeza y pubis para la práctica de la pericial consistente en la comparación del ADN y características microscópicas y peculiares y de queratinas, en su caso, con el pelo hallado por el Dr. Frontela en el cinturón de Desirée Hernández, de unos 4 cms de longitud y cano, durante la autopsia de su cadáver.
3º) El pelo hallado, de no haber sido devuelto al Juzgado instructor por el Dr. Frontela, deberá serle reclamado, llevándose a cabo los correspondientes estudios y análisis por la Clínica Médico-Forense de Valencia o por el centro u organismo debidamente capacitado que la misma determine.
4º) Se facilite en la medida de lo posible la comunicación del procesado con su letrado, eliminándose cualquier atisbo de indefensión.
5º) Deberá darse cuenta puntual y semanalmente a este Tribunal de las causa que en cada momento impidan la terminación de la instrucción, conforme a las previsiones del art.324.1 LECR.
SEGUNDO: Por no considerarse eficaz para el esclarecimiento de los hechos, no ha lugar a la práctica de la pericial solicitada referente a Ramón Losa Raga y a José Miguel Martínez Cana, dados los informes obrantes en autos, y el contenido de los mismos donde se precisa la falta de bulbo de las muestras de pelos dubitados, y la imposibilidad de llevar a cabo con ellos pruebas de como el carácter meramente complementario, no identificativo y de simple valoración de frecuencias, del examen de queratinas que se pudiera realizar.
Por todo ello,
VISTOS los arts. citados y demás de aplicación.
PARTE DISPOSITIVA
LA SALA ACUERDA, revocar el auto de conclusión del sumario dictado con fecha 3-1-96 por la Sra. Juez de instrucción nº 6 de Alzira con objeto de que se lleven a cabo las diligencias antes expresadas y las demás que fueren estrictamente necesarias para el esclarecimiento de los hechos.
Notifíquese a las representaciones de la acusación particular, de las acusaciones populares personadas, de la defensa y póngase en conocimiento del Ministerio Fiscal.
Con testimonio de la presente resolución, devuélvanse las actuaciones originales al Juzgado de su procedencia, quedando en la Secretaría de este Tribunal las piezas de convicción que no resultaron necesarias para la práctica de las nuevas diligencias para su ejecución y cumplimiento.
Remítanse al Juzgado de Instrucción para su incorporación al sumario las D.P. 3480/95 procedentes del Juez Instrucción nº 7 de Valencia sobre intervenciones telefónicas.
Así por este su auto, lo acordaron y Sres. anotados al margen, de lo que doy fe.

FOLIOS 334- 336
A LA SALA
(Sección Segunda)
JUAN ANTONIO RUIZ MARTÍN, Procurador de los Tribunales, en nombre de la Asociación “Clara Campoamor”, cuya representación ya consta debidamente acreditada en el Sumario nº 1/93 del Juzgado de Instrucción nº SEIS de los de Alzira, ante la Sala comparezco y DIGO:
Que en virtud del trámite conferido para instrucción en fecha diez del presente mes de Mayo, vengo por este escrito a solicitar la REVOCACIÓN DEL SUMARIO referenciado, con base en los siguientes:
FUNDAMENTOS
PRIMERO.- Bastaría para invocar la revocación de la causa, denunciar el incumplimiento por el Instructor de la práctica de las diligencias acordadas por esa Sala, en su auto de dieciséis de Febrero del año en curso, y en particular, la relativa a la extracción de pelos de cabeza y pubis del imputado Miguel Nicolás Cortona, para la práctica de la pericial consistente en la comparación del ADN y características microscópicas y peculiares y de queratinas, en su caso, con el pelo hallado por el Dr. Frontela en el cinturón de Desirée Hernández, de unos cuatro cm. de longitud y cano, durante la autopsia de su cadáver.
Desde luego el incumplimiento no puede considerarse arbitrario, en tanto en cuanto la Instructora fundamenta la decisión en razones materiales que versan sobre la dificultad en orden a la eventual! extracción de suficiente muestra de ADN, en relación al escaso valor identificativo que por el Juez se atribuye a la prueba en cuestión, cuenta de las numerosas personas que tuvieron algún contacto cadáveres, unido todo ello a la complejidad que reviste la práctica del análisis por la carencia de medios materiales para llevarla a cabo, e incluso atiende a derechos constitucionales cuáles son el instalado en el artículo 24.2 de la CE, derecho a un proceso sin dilaciones indebidas.
La mención al derecho constitucional a un proceso sin dilaciones indebidas, no por oportuna deja de resultar ociosa. En primer lugar porque ya fue objeto de preocupación y de valoración por esta parte y por el propio Tribunal a la hora de resolver sobre la solicitud de revocación postulada en la anterior conclusión sumarial; y en segundo lugar, porque, como allí se dijo, cuando se enfrenta el derecho a un proceso sin dilaciones indebidas con el principio de justicia instalado en el frontispicio de la Constitución, en su articulo 1, ante unos hechos de la entidad, naturaleza y gravedad de los que aquí se enjuician, no puede por menos que prevalecer la búsqueda de la verdad material o histórica en el proceso, sobre todo si se tiene presente que la duración de la presente causa, con ser larga, no puede calificarse de excesiva en relación a la complejidad de la investigación y los delitos que se imputan. Conviene recordar en este punto que no se trata tanto de que no existan dilaciones, sino de que las mismas resulten efectivamente indebidas. En todo caso no está, de más recordar que la preocupación expresada por la Instructora por el derecho a un proceso sin dilaciones indebidas requiere de algunas precisiones: De una parte que ha sido precisamente una deficiente e insuficiente instrucción lo que ha motivado las dos revocaciones precedentes, a lo que se ha unido una precipitación obvia a la hora de decretar la conclusión del sumario sin participar a las partes la eventual posibilidad de ampliar el material instructorio; y de otra, que pese a que el auto de esa Sala por el que se acordaba la práctica de nuevas diligencias de prueba es de dieciséis de Febrero del año en curso, la declaración del imputado, Miguel Nicolás Cortona, tiene lugar el día treinta de Abril, casi tres meses después, produciéndose inmediatamente después de dicha declaración, sin capacidad de reacción para ninguna de las partes, la conclusión del sumario.
Resta ahora por valorar si los argumentos esgrimidos por la Instructora para concluir sin practicar la prueba ordenada, son razonables y atendibles. El primero de los motivos radica en la imposibilidad de llevarse, a cabo en la actualidad, según informes de la clínica forense de Valencia y el Instituto Nacional de Toxicología de Madrid, la comparación del ADN al ser necesario un secuenciador automático que está pendiente de ser suministrado por el Ministerio de Justicia. Pues bien, el informe de la clínica forense de 28 de Febrero, aludía efectivamente a la necesidad de dicho secuenciador que estaba pendiente de ser suministrado por parte del Ministerio de Justicia e Interior a Instituto Nacional de Toxicología de Madrid, pero añadía asimismo que era previsible dicho suministro en el plazo de tres meses, momento en el que podría efectuarse la comparación del ADN solicitada. Quiere ello decir que a lo largo de este mes, a lo sumo y el próximo, el Instituto dispondrá de los medios necesarios. En todo caso resulta sorprendente y por tanto incomprensible que no se hallan habilitado alternativas que hubieran posibilitado la práctica de dicha prueba con todas las garantías técnicas exigibles al caso, bien remitiendo las muestras para su análisis a equipos de la Policía Científica de Inglaterra o EE.UU de los que se tiene constancia que utilizan estas técnicas, o bien habilitando las partidas o fondos necesarios con carácter perentorio, para disponer del secuenciador.
El segundo de los motivos reside según la Instructora en el hecho de que el análisis, al tratarse de un pelo sin bulbo sólo tiene interés para determinar la especie biológica a que pertenece el cabello. Desde luego se desconoce de donde ha extraído la Instructora una conclusión tan arriesgada como errónea, porque el mero análisis macroscópico basta para determinar la especie biológica, como así se ha determinado no sólo en el informe del Dr. Frontela, sino también en los informes continuación de los números BCHQ- 0345/93, BCHQ-0346/93 y BCHQ-0347/93 remitidos recientemente por el Instituto Nacional de Toxicología en fecha, .17 de Abril de 1.996, que al folio 71, muestra n” 7, lo incluye dentro de la especie humana, dado que a lo largo de todo el informe, cuando es de origen animal, lo afirma expresamente, como sucede, por ejemplo, al folio 70, muestra nº 6.
El tercer motivo, y éste si con apoyo del informe de Toxicología, alude a que, por tratarse de un pelo en unas ropas es necesario asegurar que su presencia no se ha producido durante el proceso de recogida o análisis de la muestra. Sin duda el planteamiento. sería acertado si no fuera porque no sé trata en el presente caso de verificar el carácter de dubitado del pelo hallado, sino por el contrario, de algo mucho más elemental, más simple, como es el de descartar o bien afirmar la participación criminal de un sospechoso, lo que hace innecesario llevar a cabo más verificaciones o contrastes sobre una larga serie de personas cuya participación en el hecho criminal está de entrada descartada (policía, forenses..) por razones obvias.
En cuarto lugar, resulta asimismo más que discutible el razonamiento que en el auto se recoge acerca de la fiabilidad del resultado de la prueba en cuestión. Parece deducirse que la Instructora ha concluido a priori basándose en motivos por demás hipotéticos (..”es posible que no se obtenga suficiente ADN para su realización..”), que el análisis no va a ser determinante, aun antes de producirse. Pero a ello hay que oponer dos órdenes de argumentaciones, a saber: que el carácter de determinante o no de la prueba no va a poder establecerse sino una vez llevada a cabo la misma tal y como el propio Instituto Nacional de Toxicología en su informe de 11 de Marzo de 1.996 lA señala, pero es más, de tenerse resultados positivos, pese a no ser tan discriminatoria esta prueba como las técnicas de DNA cromosómicas, proporcionaría más información que la determinación del DHL DQA1, de conformidad con el informe del Dr. Frontela; y, en segundo lugar, que la mera posibilidad de que sirviera para descartar la presencia o autoría en el lugar de los hechos del sospechoso – en el caso de que la comparación ofreciera resultados negativos en relación a las muestras indubitadas – constituiría razón más que suficiente para considerarla una diligencia de naturaleza determinante a los efectos que se persiguen y de indudable interés para el fin del proceso.
SEGUNDO.- Pese a que el auto no contiene ninguna referencia a quien ha prestado declaración en calidad de imputado a consecuencia de la anterior revocación ordenada por esa Sala, sin embargo es preciso concretar la cualidad de sospechoso que haga imprescindible la comparación del perfil genético con el pelo dubitado, como así recoge la consideración 1 D del informe del Instituto Nacional de Toxicología de uno de Marzo de 1.996.
La declaración de Miguel Nicolás ha reforzado las sospechas sobre su participación o conocimiento de los hechos objeto de investigación. En efecto, la declaración prestada el día treinta de Abril, después de rebatir las declaraciones de Mauricio Anglés sobre la oportunidad de recoger a unas niñas en autostop, “manifiesta que sólo una vez le comentaron que iban a ver a tres niñas y que si quería ir con ellos. Que el declarante dijo que no. Que se fueron Ricart y Antonio Anglés….(FALTA Folio.336

FOLIOS 396 – 400
A LA SALA SECCIÓN SEGUNDA AUDIENCIA PROVINCIAL DE VALENCIA
Dª. ISABEL CAUDET VALERO Procurador de los Tribunales y de D. FERNANDO GARCÍA MEDIANO y D. FERNANDO GÓMEZ MORENO, cuya representación consta acreditada en los presentes autos, ante la el Sumario 1/93 y, como mejor proceda en. Sala comparezco en Derecho, DIGO:
Que, habiendo sido emplazados para instrucción por término de diez días, mediante el presente escrito y al amparo de lo dispuesto en el art. 627.3 “in fine” de la Ley de Enjuiciamiento Criminal, evacuo en tiempo y forma el traslado conferido, solicitando la revocación del auto de conclusión del sumario de fecha 3.05.96 del Juzgado instructor Nº 6 de ALZIRA en orden a la práctica de las diligencias pendientes y las que se solicitan en base a los siguientes MOTIVOS
PRIMERO.- En primer lugar, el Juzgado Instructor declara concluso el presente sumario en el RAZONAMIENTO JURÍDICO PRIMERO del auto de conclusión de fecha 3.05.96 sobre la base de que a su criterio se han practicado todas las diligencias adecuadas para la investigación de los hechos, incluso las interesadas por las partes y que provocaron e1 auto de revocación de fecha 16.02.96.
Estimamos que ello es de todo punto inexacto – dicho sea en términos de respetuosa defensa – por cuanto de las pruebas propuestas por las partes únicamente se ha practicado en fecha 30.04.96 la declaración del imputado MIGUEL NICOLÁS CORTONA dos meses y medio después de haberse acordado por la Sala la práctica de ulteriores diligencias de prueba por auto de 16.02.96. Por tanto, la teleología principal de la revocación de la conclusión del sumario ha quedado frustrada, determinando ello una dilación indebida ya que no se ha cumplido aquel mandato.
SEGUNDO.- Se estima por esta parte asimismo improcedente la conclusión del sumario:
I. – En lo relativo a la dificultad mantenida por la Instructora relativa a la práctica de la prueba pericial consistente en la comparación del ADN y características microscópicas y peculiares y de queratinas entre pelo de la cabeza y pubis de MIGUEL NICOLÁS CORTONA y el hallado en el cinturón de DESIRÉE HERNÁNDEZ. Y ello por cuanto, según la Instructora “es imposible de llevarse a cabo en la actualidad… al ser necesario un secuenciador automático que está pendiente de ser suministrado por el Ministerio de Justicia e Interior…”.
No obstante, – según recientes noticias emitidas por el Departamento de Medicina Legal de la Facultad de Medicina de Valencia y por el Dr. FRONTELA CARRERAS, quien ha intervenido en la autopsia practicada en segundo término en la instrucción de la causa – el análisis de que se trata sobre el pelo en cuestión cabo en España, incluso algunas pruebas en puede llevarse a Valencia, con el auxilio de otros centros de investigación que poseen secuenciadores y otros instrumentos precisos al efecto, a cuyo efecto esta Sala ya ha oficiado a la Unidad de Medicina Legal de la Facultad de Medicina de Valencia en orden a que por la misma se emita un informe al respecto.
Por otra parte, esta representación ha solicitado y aportará a la mayor brevedad posible informe técnico del Dr. FRONTELA CARRERAS sobre el alcance, procedencia, disposición de los instrumentos necesarios, tiempo de duración de la prueba, coste y resultados del análisis de determinación de ADN mitocondrial en un fragmento de cabello sin bulbo y otros vellos púbicos en orden a la solicitud por esta parte de los oportunos análisis comparativos de ADN mitocondrial de conformidad a la súplica del presente.
II.- Sostiene la Instructora la dificultad de la práctica de la prueba referenciada sobre la base de que al tratarse de un pelo sin bulbo dicha práctica sólo tiene interés para determinar la especie biológica a que pertenece el cabello. Dicha afirmación carece de fundamentación y de rigor técnico precisos ya que del mismo informe de fecha 26.08.94 emitido por el Dr. FRONTELA CARRERAS se desprende que un análisis macroscópico es suficiente para determinar la especie biológica y asimismo lo afirma el informe emitido por el Instituto Nacional de Toxicología de fecha 17.04.96, al incluir dicho pelo dentro de la especie humana, pues cuando es de origen animal lo establece expresamente.
III.- En relación a la negativa de la Instructora a practicar la prueba analítica comparativa del ADN, el argumento que utiliza para desvirtuarla consistente en que por tratarse de un pelo en unas ropas es necesario asegurar que su presencia no se ha producido durante el proceso de recogida o análisis de la muestra, cabe aducir en primer lugar que esta parte no persigue con tal práctica inculpar a cualquier persona cuyo ADN mitocondrial coincida con la muestra a analizar, sino poder afirmar o negar la participación criminal en los hechos del sospechoso MIGUEL NICOLÁS CORTONA.
A mayor abundamiento, según noticias del DR. FRONTELA CARRERAS a confirmar técnicamente por su precitado Informe, parece ser que la cana de que se trata (folio 71 del informe del I.N.T. de fecha 17.04.96 y folio 190 del informe del Dr. FRONTELA de 26.08.94) se encontró entre el tejido de las ropas y un barro o barrillo existente antes de la extracción de los cadáveres de la fosa, lo cual descarta de plano – según el criterio del citado profesional – la posibilidad de pertenencia a cualquier persona que hubiera intervenido a la manipulación posterior a los cadáveres; asimismo nos informa dicho profesional de que con algunas pruebas preliminares se pueden obviar o descartar las que resulten innecesarias y así economizar sustancialmente su coste.
IV. – La Instructora afirma que la práctica pericial meritada no sería determinante para la resolución de la causa. Dicha afirmación no constituye más que una hipótesis carente de rigor pues, de los Informes emitidos por el Instituto Nacional de Toxicología y por el Dr. FRONTELA, así como de las recientes informaciones emitidas por el Departamento de Medicina Legal de la Facultad de Medicina de Valencia se desprende con claridad meridiana que, en principio, los resultados del análisis son fiables, absolutos y eficaces; que dicha prueba constituye un elemento identificador y que el grado de probabilidad o certeza de llegar a un resultado infalible no se puede establecer “a priori”, sino una vez finalizada la práctica de la prueba, ya que los obstáculos que pueden encontrar los
peritos – como el deterioro del pelo en cuestión – no pueden determinarse de antemano.
TERCERO.- De la declaración de MIGUEL NICOLÁS CORTONA prestada ante el Juez Instructor en fecha 30.04.96 se desprenden datos de interés relevantes para esclarecer ciertos extremos y que hacen necesaria la práctica de la prueba pericial para determinar, entre otras cuestiones, su participación o no en los hechos.
Asimismo, según el último informe remitido por el Instituto Nacional de Toxicología de fecha 17.04.96 y el segundo del Dr. FRONTELA se admite la inequívoca participación de, al menos, una tercera persona.
CUARTO.- En conclusión, cabe aducir que se han producido novedades en el sentido de la posibilidad de practicar análisis de ADN mitocondrial y que ello podría esclarecer más los hechos determinando con mayor rigor y certeza la participación en los mismos; que la precitada prueba o análisis se pueden iniciar con preliminares que determinen, de una parte, su conveniencia y, de otra, su exclusión o innecesariedad; que se han encontrado cabellos y vellos púbicos cuyo análisis comparativo ahora sí que podría realizarse con los ya extraídos de las diversas personas involucradas; que dichas personas figuran en las declaraciones de los inculpados y demás diligencias practicadas; que, asimismo dichas personas se relacionan a los folios 3 y 4 del informe del I.N.T. de 17.04.96 y las muestras de sus cabellos y vellos púbicos están nítidamente referenciadas.
Sobre todo, consideramos a los presentes efectos la circunstancia del hallazgo de vellos púbicos en los cadáveres, no pertenecientes a las víctimas, son determinantes con mayor exactitud de la participación criminal en los hechos, por cuanto su existencia no es casual en absoluto, dada la dificultad de su desplazamiento, al contrario que los cabellos que se desprenden y se trasladan con mayor facilidad de un lugar a otro. Asimismo, también se desprende la conveniencia de la práctica probatoria que solicitamos de los criterios periciales y criminalísticos expuestos por el Dr. FRONTELA en los folios 79 a 81, 99, 170-171, 190, 246-248, 261, 262 y 285 (fig. y conclusión Nº 4.23) de su repetido informe de 26.08.94 por cuanto se desprende con rigor técnico la participación de, al menos, tres personas.
Por todo lo anterior, estimamos de todo punto procedente que se practiquen, las pericias que seguidamente solicitamos en aras al reiterado valor superior de justicia porque sinceramente pensamos que pudieran esclarecer aún más los hechos a enjuiciar por último, siquiera también desde el punto de vista o criterio de exclusión que permitiera incluso descartar hipótesis.
Consecuentemente con todo lo expuesto en el cuerpo de este escrito, dado que ha sido determinada la alta probabilidad de participación de otras personas en los hechos, derivada de los informes forenses y en aras al valor superior de justicia consagrado en el art. 1 de la Constitución, esta parte solicita la revocación de la conclusión del sumario y que por el Instructor se practiquen a la mayor brevedad posible a fin de evitar mayores dilaciones las siguientes diligencias en orden a esclarecer ciertos extremos relevantes para la resolución de la causa:
lº.- Extracción de pelos de cabeza y pubis de MIGUEL NICOLÁS CORTONA y su comparación mediante análisis de ADN mitocondrial con los pelos dubitados encontrados entre las ropas de los cadáveres y, en particular, con el del pelo cano hallado en el cinturón de DESIRÉE HERNÁNDEZ FOLCH que se halla referenciado al folio 4 del informe del I.N.T. de 17.04.96 como muestra “M-7” del apartado “Cadáver Nº 2 (346/93)”
2º.- Análisis comparativo de ADN mitocondrial de los pelos dubitados que figuran relacionados en los folios 4 y 5 del informe del I.N.T. de fecha 17.04.96 bajo las rúbricas “M” de los apartados 345/93, 346/93 y 347/93 correspondientes a los tres cadáveres de ANTONIA GÓMEZ RODRÍGUEZ, DESIRÉE HERNÁNDEZ FOLCH y MIRIAM GARCÍA IBORRA; los pelos hallados en el colchón y trozo de espuma bajo la rúbrica “S”; las muestras recogidas en el OPEL CORSA bajo la rúbrica “m” y las muestras obtenidas en el SEAT RONDA bajo la rúbrica “C”.
Todos los anteriores a comparar con los cabellos y vellos púbicos indubitados de:
a).- MIGUEL RICART TÁRREGA, ROBERTO, JOAQUÍNMAURICIO y ENRIQUE ANGLÉS MARTÍNS, LUIS RIBERA GALLARDO, ANTONIO LOSA RAGA y JOSÉ MIGUEL MARTÍNEZ CANA que figuran relacionadas a los folios 3 y 4 de dicho informe y
b).- con las muestras que se extraigan de MIGUEL NICOLÁS CORTONA según lo solicitado en el apartado 1º anterior.
3º.- Concreto y detallado análisis comparativo de ADN mitocondrial de vellos púbicos de MIGUEL RICART TÁRREGA ya extraídos, con los vellos púbicos recogidos en el cadáver de ANTONIA GÓMEZ RODRÍGUEZ, cuya conveniencia se desprende de lo expuesto en los folios 70 y ss. del informe del I.N.T. de fecha 17.04.96 y del informe del Dr. FRONTELA CARRERAS (folio 99 y 109).
Por último, dada la magistral intervención y colaboración prestada en la presente causa por el Dr. D. LUIS FRONTELA CARRERAS desinteresadamente y siguiendo expresas instrucciones y deseos de mis representados se solicita igualmente la intervención de dicho profesional en las pericias que se interesan, como eminencia en Medicina Legal y Forense, y por cuanto dicho profesional está dispuesto a ello según escrito e informe que se ofrecen a la Sala por si lo estimase necesario y previo. Por lo que se interesa la comunicación o requerimiento a dicho Sr. en orden a su intervención pericias.
En virtud de lo expuesto, procede y SUPLICO A LA SALA que, teniendo por presentado este escrito y copias se digne admitirlo, tenga por evacuado el traslado al que se contrae y por efectuadas las manifestaciones que contiene y, en su consecuencia, tenga por instada la revocación del auto de conclusión del sumario de fecha 3.05.96 y, en méritos a lo expuesto, acuerde la práctica de las diligencias pendientes y las propuestas por esta parte en el MOTIVO CUARTO del presente a la mayor brevedad posible, a cuyo efecto acuerde y ordene asimismo se requiera al Instituto Nacional de Toxicología para que remita a las presentes actuaciones y a la atención del organismo competente todas las muestras de los cabellos obtenidas en la causa y se requiera asimismo al Dr. D. LUIS FRONTELA CARRERAS a la Cátedra de Medicina Legal de la Universidad de Sevilla a fin de que intervenga y colabore en la práctica de las diligencias solicitadas en el sentido expuesto, por ser todo ello ajustado a Derecho.
Justicia que pido en Valencia, a 17 de junio de 1996.
Fdo. Vicente Attard Fdo. Isabel Caudet.

FOLIOS 408 – 409
AUDIENCIA PROVINCIAL – SECCIÓN SEGUNDA – VALENCIA ALZIRA-6 SUMARIO 1-93 PROVIDENCIA
Ilmos. Sres. Presidente: D. FRANCISCO MONTERDE FERRER
Magistrados: D. MARIANO TOMAS BENÍTEZ y Dª. CARMEN LLOMBART PÉREZ
En VALENCIA, a diecinueve de Junio de mil novecientos noventa y seis.
Dada cuenta; visto el contenido del escrito recibido en esta Sección en el día de hoy, suscrito por la procuradora Sra. Caudet Valero en representación de la acusación particular, requiérase a la referida parte para que a la mayor brevedad precise, si dada la extraordinaria dilación que ha supuesto para la conclusión de la causa la intervención del Dr. Frontela éste, efectivamente ha precisado el tiempo en que podría llevar a cabo, con los elementos de que dispone, los análisis que se solicitan y sí efectivamente lo haría de modo totalmente desinteresado, comprometiéndose a comparecer en la vista del  juicio oral cualquiera que fuere su fecha.
Habiendo solicitado también la representación de la Asociación Clara Campoamor la practica de análisis de ADN mitocondrial y adhiriéndose a dicha solicitud la representación de Dª. Lourdes Alonso, ambas partes personadas como acción popular, déseles traslado al igual que a la acusación particular a fin de que manifiesten si en el caso de acordarse encomendar la pericia a la Unidad de Medicina Legal de la Facultad de Medicina de Valencia, esa parte, conforme al presupuesto que ha remitido la referida Unidad, que obra en las actuaciones y cuya copia se pone a disposición de las partes, estarían dispuestas a asumir su coste económico.
Lo acuerda la Sala y lo rubrica el Iltmo. Sr. Presidente. Doy fe.
DILIGENCIA.- Seguidamente se cumple lo acordado, doy fe.

FOLIOS 413 – 415
A LA SALA (Sección Segunda)
Francisco García Albert, Procurador de los Tribunales, en nombre y representación de Miguel Ricart Tárrega, cuya representación consta acreditada en el Sumario 1/93’del Juzgado de Instrucción nº tres de Alzira, ante la Sala comparezco y, como mejor proceda en Derecho, DIGO:
Que en virtud del trámite conferido a esta parte para instrucción en fecha 19 de Junio, vengo, por medio del presente escrito a solicitar la REVOCACIÓN DEL SUMARIO de referencia, adhiriéndome a las solicitudes formuladas por el resto de las partes, con base a los siguientes
FUNDAMENTOS:
PRIMERO.- En primer lugar debemos hacer mención a la necesidad de tener que reiterar una y otra vez nuestra solicitud de traslado del Sr. Ricart a la prisión de Castellón, al objeto de poder comunicar suficientemente con él y ver la oportunidad de solicitar la práctica de algún tipo de prueba. Cuando por fin la Juez Instructora tiene a bien acceder al traslado para la comunicación, la que se produce en fecha siete de mayo de 1.996, nos encontramos ante la desagradable sorpresa de que cuatro días antes de que pueda comunicar el Letrado con Miguel Ricart se dicta auto por el que se da por terminado el presente Sumario. Todo esto siendo que se dictó auto por la sección segunda en fecha 16 de Febrero de 1.996 en la que se acordaba que “Se facilitase en la medida de lo posible la comunicación del procesado con su letrado, eliminándose cualquier atisbo de indefensión.”, sin embargo no se puede llevar a cabo dicha comunicación hasta la fecha antedicha, esto es casi tres meses después. Lo que no ha hecho sino llevar a la indefensión que se pretendía evitar.
SEGUNDO. – Nos llama igualmente la atención que la Juez instructora dé por concluido el sumario en ara a los principios que informan al derecho penal de un proceso sin dilaciones indebidas, siendo que para tomar declaración al Sr. Nicolás se tardó más de dos meses. Sin que aparentemente haya justificación alguna de la demora.
No obstante entendemos que debe prevalecer la búsqueda de la verdad material a la celeridad. Siendo además un asunto de la importancia y trascendencia del que nos ocupa y siendo que hasta el momento no se ha podido llegar a la real averiguación ni de los hechos ni de los verdaderos autores materiales de los delitos.
Deberán practicarse todos aquellos medios de prueba de que puedan valerse para llegar hasta el final en la averiguación de los hechos y de sus autores. Poniendo por parte de la administración de justicia todos los medios necesarios para tal fin, tenga el coste que tenga. No pudiendo en ningún caso dejar por motivos económicos sin resolver ni clarificar un caso de la magnitud del que nos ocupa.
La práctica de tales pruebas deberá hacerse con la mayor celeridad posible, y no retrasando el procedimiento sin justificación alguna y quizá posteriormente tomar como excusa el principio de un proceso sin dilaciones.
El auto de conclusión del sumario dice que “…para determinar la prueba biológica a la que pertenece el cabello, que es posible que no se obtenga suficiente ADN para su realización..”..cuando dice que es posible que no se obtenga suficiente ADN, igualmente se está diciendo que si que es posible que lo haya, por lo tanto se está dejando de practicar una prueba que la propia Juez llega a la conclusión de que posiblemente que exista suficiente ADN para poder comparar.
TERCERO.- Respecto quien deberá realizar la prueba pericial solicitada y a la que nos adherimos, interesamos que sean el Departamento de Medicina Legal de la Facultad de Medicina de Valencia, por tener noticias de que con la ayuda de otros centros de investigación de España podrá practicar dichos análisis ofreciendo las mayores garantías de objetividad y sobre todo de celeridad.
Dada la tardanza con que emitió su informe el Dr. Frontela en su anterior peritación, cabe prever que la emisión, de un nuevo informe no haría más que retrasar un procedimiento que no admite más dilaciones que las estrictamente necesarias. Siendo que el Departamento de Medicina Legal de la Facultad de Medicina de Valencia nos ofrece todas las garantías para la práctica de dicha peritación, no siendo necesario el tener que contrastar su resultado con peritaciones interesadas por alguna parte. De igual modo que era más que suficiente el dictamen que emitió en su día el Instituto Nacional de Toxicología. Pues el posterior y tardío informe del Dr. Frontela no iluminó ni complementó lo más mínimo el primer y completo informe del citado Instituto. Consecuentemente entendemos que el resultado de las peritaciones no admite opinión sino únicamente dictámenes objetivos y precisos sobre pelos sujetos a comparación, por lo que con concordancias entre los diferentes un único dictamen será más que suficiente y no dará lugar a mayores e innecesarios retrasos.
En su virtud, SUPLICO A LA SALA: Que, teniendo por presentado el presente escrito y sus copias, se digne admitirlo, tenga por instada la revocación del auto de revocación del sumario de fecha tres de Mayo de 1.996, y acuerde la práctica de las pruebas que en su día se acordaron y están pendientes de práctica, así como las interesadas por las partes en el presente procedimiento, acordando requerir al Departamento de Medicina Legal de la Facultad de Medicina de Valencia a fin de que colabore en la práctica de las diligencias solicitadas.
En Valencia a 24 de Junio de 1.996.
VICENTE QUILIS VENTIMILLA – Colegiado nº 4407

FOLIOS 419 – 422
A LA SALA SECCIÓN SEGUNDA AUDIENCIA PROVINCIAL DE VALENCIA
Dª. ISABEL CAUDET VALERO, Procurador de los Tribunales y de D. FERNANDO GARCÍA MEDIANO y D. FERNANDO GÓMEZ MORENO, cuya representación consta acreditada en los presentes autos, ante la Sala comparezco en el Sumario 1/93 y, como mejor proceda en Derecho, DIGO:
Que, mediante el presente escrito, evacuo el traslado conferido por proveído de fecha 19.06.96 notificado en 20.06.96, a cuyo efecto formulo las siguientes ALEGACIONES
PRIMERA. – En primer lugar y, en relación al tiempo en que podría llevarse a cabo los análisis que se piden por esta representación en escrito de fecha 17.06.96 por el que se solicitaba la revocación del auto de conclusión del sumario de fecha 3.05.96 por el Juzgado Instructor de Alcira, cabe hacer la siguiente matización: que si bien el análisis definitivo tardaría UNO 0 DOS MESES, como máximo, aproximadamente desde que los pelos objeto del mismo se pongan a disposición del DR. FRONTELA CARRERAS, es decir, que podría estar concluido en el mes de octubre del corriente, cabe la posibilidad – según nos informa el DR. FRONTELA – de realizarse por el mismo una prueba inicial o preliminar, cuya duración sería de UNA SEMANA, que serviría para excluir – por imposibilidad técnica o por deterioro de los pelos – la práctica de la prueba de análisis del ADN mitocondrial definitiva en algunos o en todos los pelos a analizar.
En segundo término y en lo referente a la disposibilidad y compromiso de comparecer a la vista del juicio oral, el Profesor FRONTELA nos comunica y confirma totalmente dicha disponibilidad siempre y cuando fuere citado a dicho señalamiento con al menos UN MES de antelación, en orden a poder planificar su agenda a los expresados efectos.
La referencia o aclaración relativa a la realización desinteresada queda igualmente corroborada en el presente en el sentido indicado en la subsiguiente alegación
TERCERA en la que únicamente se señalan los costes de la realización de las pruebas.
SEGUNDA.- Es aconsejable que la práctica de la prueba se realice en el departamento de Medicina Legal de la Facultad de Santiago de Compostela (La Coruña), dados los medios y técnicas más avanzados de que disponen, pues según noticias del Profesor FRONTELA, disponen de un aparato muy moderno.
Esta representación quiere dejar constancia de que el Profesor FRONTELA ha aconsejado el Reino Unido como lugar o sede prioritaria para la práctica probatoria de que se trata por la acumulada experiencia las técnicas avanzadas y la última tecnología sobre la materia, en la que es pionera dicho país a nive1 europeo. No obstante, expresamos nuestra inevitable debido a renuncia a la práctica en dicho país, las limitaciones de tiempo y presupuesto que nos acucian.
Dicha práctica se llevaría a cabo por el Dr. FRONTELA en colaboración con el profesor CARRACEDO, a cuyo efecto aconseja el DR. FRONTELA que el problema primordial está centrado en el cotejo de los pelos que se hallaron sobre la ropa o cadáveres con los pelos de los sospechosos, sobre los cuales esta parte mantiene su solicitud de que se amplíe en esta nueva diligencia pericial a MIGUEL RICART TÁRREGA, ROBERTO, JOAQUÍN-MAURICIO y ENRIQUE ANGLÉS MARTÍNS, LUIS RIBERA GALLARDO, RAMÓN-ANTONIO LOSA RAGA y JOSÉ-MIGUEL MARTÍNEZ CANA. Para ello deberían darse los siguientes pasos:
lº.- Un estudio microscópico, no destructivo, de comparación, de los pelos dubitados con los indubitados de todos los presuntos sospechosos antes indicados y referenciados en nuestro escrito de fecha 17.06.96. (Con este preliminar no sólo se despejará o disipará las dudas iniciales de la pericia, sino también que se abaratará su coste por la exclusión, en su caso, de aquellas pruebas que resulten innecesarias)
2º.- Una vez efectuado este estudio, con los pelos que microscópicamente guardasen entre sí identidad o aproximación, efectuaría el DNA mitocondrial.
TERCERA.- En relación al precio o coste de la pericia ésta viene a ser según el Profesor FRONTELA sensiblemente similar a indicada por el Departamento de Medicina Legal de la Facultad la de Valencia, por cuanto el análisis de cada pelo oscila entre 200.000 y 250.000 pesetas, si bien se ajustará más al mínimo de 200.000 pesetas si tras las pruebas preliminares procediese el análisis mayoritario de los pelos.
En este sentido, nos ha confirmado el Dr. FRONTELA su participación y colaboración desinteresada en la práctica de la pericia de que se trata, si bien únicamente deberá abonársela el importe de los gastos de desplazamiento o dietas precisas para las diligencias probatorias y comparecencia al acto de la vista.
Por consiguiente, entendemos que este es un factor importante más que hace aconsejable y procedente la intervención del equipo compuesto por los profesores FRONTELA y CARRACEDO (este último de la Universidad de Santiago de Compostela) , por cuanto – como se ha indicado – en Santiago de C. disponen de un aparato muy moderno y adecuado al efecto y los profesionales que forman el equipo son de sumo prestigio, el primero de ellos por ser notorio su reconocimiento mundial en la materia y, el segundo, por cuanto es titular en la Universidad a la que pertenecen los instrumentos más sofisticados y avanzados en la materia que existen en España.
CUARTA. – Dado el considerado coste que supondría el análisis del ADN mitocondrial de la suma de todos los pelos que se desearía analizar, ésta representación se ve en la necesidad de limitar y reducir las diligencias de prueba solicitadas en el MOTIVO
CUARTO de su escrito de fecha 17.06.96 por el que se solicitaba la revocación del auto de conclusión del sumario de fecha 3.05.96 por el Juzgado Instructor de Alcira y, en este sentido, solicitamos sean analizados los ADN mitocondrial únicamente de los vellos púbicos que se hallaron sobre los cadáveres, respecto a los sospechosos referenciados en nuestro escrito de fecha 17.06.96 que se mantienen como objeto del análisis comparativo solicitado, limitándose la concreción o minoración del presente escrito al número de pelos a analizar, ya que como ya se indicó en el escrito meritado,
su existencia no es casual en absoluto, dada la dificultad de su desplazamiento, al contrario que los cabellos que se desprenden y se trasladan con mayor facilidad de un lugar a otro.
Consecuentemente con lo anterior, esta parte solicita definitivamente el análisis del ADN mitocondrial de los siguientes vellos púbicos (en total 12) y el cabello cano encontrado en el cinturón de DESIRÉE HERNÁNDEZ FOLCH a tenor del informe emitido por el Instituto Nacional de Toxicología de fecha 17.04.96:
Muestra nº 3 del apartado 36º): vello de tipo púbico de 51 mm de longitud y 125 micras de diámetro máximo, tiene fusis en el extremo proximal y médula continua de tipo visible, la raíz está en fase telógena; este pelo no presenta semejanza con los indubitados (pág. 70 del citado informe).
NOTA: Se incluye esta muestra como objeto de pericia por criterio extensivo y de prudencia, a pesar de la contradicción que al parecer existe entre lo indicado al final del primer párrafo de la pág. 70 y la nota concluyente de dicho apartado 36º de la misma, comparado con las conclusiones 35ª y 36º al folio 82 del informe, donde al parecer hay confusión, por cuanto indica en la primera de ellas semejanzas con pelos de DESIRÉE HERNÁNDEZ cuando lo cierto es que se refiere al “cadáver nº 1” que corresponde al de ANTONIA GÓMEZ y, en la segunda, indica semejanzas con los de ANTONIA GÓMEZ, cuando lo cierto es que se refiere al “cadáver nº 2” que corresponde a DESIRÉE HERNÁNDEZ.
Muestra nº 4 del apartado 37º): vello de color rubio con la raíz en fase telógena; este vello no se asemeja a los indubitados analizados (pág. 71 del informe).
Muestra nº 6 del apartado 37º): tres vellos. Uno tiene la raíz en f ase anágena; otro presenta rotura postmortem del tallo y el último carece de raíz por estar roto o cortado (pág. 71 del informe).
Muestra nº 7 del apartado 37º): cabello cano de 40 mm de longitud y 55 micras de diámetro, tiene la raíz en fase telógena, fusis en el extremo proximal y médula continua discontinua de tipo mixto; este pelo no presenta semejanza morfológica con ninguno de los cabellos dubitados e indubitados analizados (pág. 71 del informe).
Muestra nº 1 del apartado 38º) dos vellos. El de color castaño oscuro presenta rotura postmortem del extremo proximal del tallo, el de color rubio tiene raíz en fase telógena (pág. 72 del informe).
Muestra nº 4 del apartado 38º): cinco vellos. Tres de los vellos tiene raíces en fase telógena, uno catágena con desprendimiento postmortem y otro presenta rotura postmortem del tallo. Estos vellos presentan todos características morfológicas semejantes (pág. 72 del informe).
En su virtud, procede y SUPLICO A LA SALA que, teniendo por presentado este escrito y copias se digne admitirlo, tenga por evacuado el trámite al que se contrae y, en su consecuencia, tenga
por hechas las alegaciones que en el mismo se contienen y por reducidas y concretadas las muestras de pelo y vellos púbicos objeto del análisis del ADN mitocondrial ya solicitado en nuestro escrito de fecha 17.06.96, para en su momento y a la brevedad posible revocar la conclusión del sumario en orden a la práctica de las pericias de que se trata y derivadas, por ser todo ello ajustado a Derecho.
Justicia que pido en Valencia, a 27 de junio de 1996.

Fdo. Vicente Attard.

Fdo. Isabel Caudet.

 

FOLIOS 434 – 436
A LA SALA SECCIÓN SEGUNDA DE LA AUDIENCIA PROVINCIAL DE VALENCIA
Dª. ISABEL CAUDET VALERO, Procurador de los Tribunales y de D. FERNANDO GARCÍA MEDIANO y D. FERNANDO GÓMEZ MORENO, cuya representación consta acreditada en los presentes autos, ante Sala comparezco en el Sumario 1/93, y como mejor proceda en Derecho, DIGO:
Que, mediante el presente escrito, interpongo RECURSO DE SÚPLICA contra el auto de 1.07.96, notificado en la misma fecha al amparo de lo previsto en los arts. 211, 236 y 238 de la Ley de Enjuiciamiento Criminal y en base a los siguientes MOTIVOS
PRIMERO.- En primer lugar, nos referimos a que el auto impugnado omite pronunciarse, y tácitamente deniega, sobre la intervención del DR. FRONTELA solicitada por esta parte en su escrito de 27.06.96, en colaboración con el Profesor Sr. CARRACEDO – este último como titular del departamento de Medicina Legal de la Facultad de Medicina en Santiago de Compostela – ambos en íntima conexión; el primero de ellos, celebridad en la materia de la pericia de que se trata.
Asimismo, nada dice el auto sobre el bajo coste y la intervención desinteresada del Profesor FRONTELA en colaboración con el Profesor CARRACEDO.,
Estimamos procedente la resolución expresa sobre tales aspectos y, por tanto, improcedente el auto denegatorio en el sentido impugnatorio que nos ocupa, por cuanto, conociendo el prestigio de ambos profesionales y considerando que el departamento de la Facultad de Valencia vendría y viene obligado a colaborar con aquél, no se alcanza a comprender la omisión o, en cualquier caso, el parecer de la Sala por su tácita denegación, máxime cuando ha sido el propio Tribunal el que nos emplazó y dio traslado al efecto por auto de fecha 19.06.96.
A mayor abundamiento, fue precisamente el Profesor FRONTELA CARRERAS quien halló el cabello de que ahora se trata – según consta en autos – y cuyo análisis determina el Auto que aquí recurrimos.
SEGUNDO. – Se entiende como fundamentación necesaria pero no suficiente las limitaciones por el tiempo impuestas por el agotamiento de plazo de la prisión preventiva de MIGUEL RICART TÁRREGA. Y ello es así porque el problema que entraña la limitación de la figura de la prisión preventiva, en todo caso, puede considerarse como un defecto del sistema que no se puede achacar o imputar a las partes, y menos aún a los representantes de las familias de las víctimas.
Tampoco se puede reconducir la cuestión al tema de la limitación temporal, dicho sea con el debido respeto, por cuanto la misma en modo alguno se ha concretado ni fundamentado debidamente, pues esta parte desconoce técnica y procesalmente cuál es dicha limitación, dado que al parecer pesan ulteriores condenas firmes sobre el acusado en cuestión (por todo lo cual, a nuestro parecer, deberá impedirse a toda costa su puesta en libertad, por ser de justicia y conforme a derecho) ; ello se puede paliar si todos ponemos empeño en que se agilice el proceso como bien apunta la Sala respecto al Juzgado Instructor en relación a los informes semanales y, a mayor abundamiento, no es en absoluto achacable a esta parte ni a las restantes acusaciones que solicitan la dilación
probatoria.
TERCERO.- Igualmente, el meritado auto omite todo lo referente al coste, tiempo y demás circunstancias requeridas por proveído de fecha 19.06.96 y evacuadas por esta representación por escrito de 27.06.96.
A este respecto se aduce como motivo impugnatorio, igualmente el hecho ineludible de que sería muy poco tiempo más el que se llevaría la práctica del análisis de unos cuantos vellos más que los acordados en el auto que se impugna y que han sido solicitados y concretados por esta parte en su escrito de 27.06.96. Incluso cabría facultar a los peritos intervinientes en la pericia de que se trata para que, si alguna muestra resulta descartada en el examen preliminar convencional y microscópico previo al análisis del ADN, se pudieran analizar incluso otros vellos de los solicitados por esta parte según la sana crítica del equipo pericial.
Todo ello, velando por la máxima agilización de los trámites probatorios en la Instrucción que se reabre.
A su vez, cabe recordar – pues tampoco se ha dicho nada al respecto en el auto y quizá convenga hacer hincapié al instructor en tal sentido – que en la pericia habrá de cuidarse al máximo de no destruir las muestras con el análisis directo del ADN, ordenando al efecto que previamente se realicen dichos análisis microscópicos convencionales en orden precisamente a esa aproximación inicial que no sólo ahorraría costes innecesarios sino que evitará destrucción de muestras como al parecer ya ha sucedido en alguna ocasión.
CUARTO.- Debemos rechazar de plano el calificativo de “indebidas” que, a “sensu contrario”, está implícito en la fundamentación de la denegación respecto a las diligencias probatorias que esta parte ha solicitado, pues se podría pensar a tenor de la misma que tratamos de dilatar indebidamente el procedimiento, nada más lejos de lo que pretende esta parte, que simple y llanamente se limita a obtener el máximo de esclarecimiento posible de los hechos dentro del más estricto criterio de justicia y con los medios a nuestro alcance; dicho sea en términos de respetuosa defensa.
Estimamos, según criterio colegiado de diversos profesionales, que la dilación solicitada respecto a los vellos púbicos es bastante más que debida, procedente y necesaria para el interés público que impera en el proceso penal. Por tanto, nos parece que el criterio de prudencia, así como el de seguridad jurídica debe imperar en este trámite y, por ello, solicitamos la revocación del auto en orden a la práctica del resto de análisis, Por cuanto sería simultáneo y no aumentaría el tiempo más que sensible y mínimamente.
Esta es cuestión prioritaria y en justicia suplicamos con el altísimo respeto y consideración que la Sala nos merece se revoque su decisión de analizar únicamente un cabello y acuerde la de algunos más de los solicitados por esta parte concretamente por cuanto su procedencia determina a priori una alta probabilidad de esclarecimiento de los hechos enjuiciados y de sus partícipes.
En su virtud, procede y SUPLICO A LA SALA que, teniendo por presentado este escrito y copias se digne admitirlo, tenga por interpuesto en tiempo y forma recurso de súplica contra auto de fecha 1.07.96 notificado en la misma fecha por los motivos aducidos en el cuerpo del presente escrito, por ser todo ello ajustado a Derecho.
Justicia que pido en Valencia, a 5 de julio de 1996.
Fdo. Vicente Attard Torró Fdo. Isabel Caudet Valero.

FOLIOS 480 – 483
AL JUZGADO DE INSTRUCCIÓN Nº 6 DE ALZIRA
D. DANIEL PRATS GRACIA, Procurador de los Tribunales y de D. FERNANDO GARCÍA MEDIANO y D. FERNANDO GÓMEZ MORENO, cuya representación Consta acreditada en los presentes autos, ante el Juzgado comparezco en, el Sumario 1/93 y, como mejor proceda en Derecho, DIGO:
Que, estando abierto el periodo instructor en el Sumario en que comparezco, mediante el presente escrito, intereso . la práctica de determinadas diligencias probatorias de suma importancia, no sólo por su contenido, sino por algunos hechos o averiguaciones que determinan procesalmente su interés y su práctica; así como para la correcta preparación de las conclusiones provisionales en su momento; todo ello al amparo de lo dispuesto en los arts. 311, 421 y concordantes de la Ley de Enjuiciamiento Criminal y a tenor de las siguientes ALEGACIONES
SEGUNDA.- En segundo término, es de suma importancia analizar la CINTA DE VÍDEO DE LAS AUTOPSIAS por cuanto se hace patente que su examen da una mayor y más completa imagen y contenido del levantamiento y de los datos y pistas que se encuentran en el lugar y momento del mismo.
En este sentido es de resaltar el hecho determinado tajantemente por las autopsias del I.N.T. (TOMO 7) y del Dr. Frontela Carreras que “…revelan una intervención animal … “.en el dorso del cadáver Nº 2, mayormente, y menor en los otros dos, lo cual sería imposible de no haber estado depositados previamente los cuerpos desnudos en otro lugar, puesto que la ropas aparecen intactas paradójicamente.
Lo anterior ya requeriría de por sí un examen detenido de la filmación de las autopsias, no obstante el principal motivo es que esta parte no ha tenido oportunidad de visionar dicho material probatorio sumarial por lo que queda plenamente justificado su interés y su derecho como parte a tomar vista del mismo previamente al cierre definitivo del Sumario, en aras exclusivamente de la estricta aplicación de los principios rectores de la investigación sumarial, entre ellos el de búsqueda de la verdad material

FOLIOS 562- 564
A LA SALA SECCIÓN SEGUNDA DE LO PENAL AUDIENCIA PROVINCIAL DE VALENCIA
Dª. ISABEL CAUDET VALERO, Procurador de los Tribunal y de D. FERNANDO GARCÍA MEDIANO y D. FERNANDO GÓMEZ
MORENO, cuya representación consta acreditada en los presentes autos, ante la Sala comparezco en el Sumario 1/93, procedente del Juzgado Instructor Nº 6 de ALZIRA y, como mejor proceda en Derecho, DIGO:
Que, mediante el presente escrito interpongo en tiempo y forma RECURSO DE SÚPLICA contra el Auto de la Sala de fecha 29.11.96, al amparo de lo dispuesto por los arts. 236, 238,211 y concordantes de la Ley de Enjuiciamiento Criminal (L.E. Crim.) por estimarlo contrario a derecho y a los legítimos intereses de las partes -con el debido respeto- y a tenor de los siguientes MOTIVOS
PRIMERO.- En primer lugar, resulta que el aserto expuesto en el razonamiento jurídico PRIMERO del auto impugnado relativo al “interés. . . sociedad en general. . . actitud del Órgano Jurisdiccional… dirigida a evitar una dilación temporal en la dispensación de la Justicia” es totalmente compatible con solicitud de práctica de diligencias, pues después de cuatro años debieran haberse practicado y no ha sido así, si bien la única excusa – incluso del principio del proceso sin dilaciones indebidas- que existe al respecto es que antes no existía posibilidad de practicar la prueba de que se trata y ha sí, lo cual fundamenta y justifica sobradamente nuestra petición.
En el propio razonamiento PRIMERO del auto se dice “…el respaldo a peticiones cuyo fundamento resulta dudoso constituye en una dilación indebida..”. Y con todo el respeto o humildad que nos cabe, no alcanzamos a entender lo que quiere decir la Sala con la expresión dudoso, puesto que nuestra petición solo es guiada por el más riguroso y pleno interés de Justicia posible sin planteamientos infundados ni dudosos, máxime cuando la fiabilidad de la diligencia solicitada es “absolutamente fiable”, como dice el propio informe de 28.11.96 de las Forenses Sras. ALER Y GISBERT. Ello desvirtúa totalmente la inutilidad o innecesariedad que sería lo único que se podría aducir para denegar, puesto que desde otro aspecto es punto legal lo que se propone.
Por último entendemos, a tenor de lo dispuesto en el arto 311 y concordante s de la L.E.Crim., que el hecho de fallos en el sistema procesal o judicial tales como que “el transcurso del tiempo” debido a la práctica de una diligencia o instrucción sumarial tan importante como la que se solicita pueda “…imposibilitar el enjuiciamiento pretendido..”, no puede justificar nunca que se juzgue a alguien previa una instrucción insuficiente, pues el resultado podría ser tan contraproducente como que no se pudiera condenar a un presunto responsable penal precisamente por dicha insuficiencia instructora. Lo cual puede ocurrir en nuestro caso según nuestro criterio, por muy lamentable que sea. Pues en cuanto a la “alarma social” cabe aducir lo mismo y sobre todo que no se trata de una dilación indebida, sino -a nuestro entender y todas las acusaciones- más que debida, obligada para el buen fin de la causa penal.
Por tanto, estimamos que los prioritarios intereses de justicia aquí invocados en sede impugnatoria (proceso público sin dilaciones indebidas con todas las garantías, seguridad, justicia, tutela judicial, no indefensión, legalidad, inmediación. . .) deben prevalecer de todo punto sobre posibles alarmas sociales, plazos, etc., pues la diligencia solicitada ni se considera indebida, ni inútil, ni innecesaria, precisamente por la imposibilidad de vaticinio o de criterio apriorístico al respecto. Entiéndanse citadas por último todas las normas y jurisprudencia razonadora de la práctica de diligencias y del proceso penal público con plenas garantías, a utilizar los medios de prueba pertinentes que conoce perfectamente la Sala.
SEGUNDO.- El aserto en el correlativo el auto que impugnamos de que “.. la revocación sumarial pretendida se limita a la práctica del análisis del ADN mitocondrial de unos pelos que ya han sido objeto de otros… en el I.N.T., cuya valoración negativa. . . presupone razonablemente las escasas posibilidades de tales diligencias “, lo consideramos algo inexacto desde dos ópticas: a).- no todos los pelos que ahora se solicita analizar han sido objeto de análisis, y b).- no existe valoración negativa concreta al respecto por el Juzgado instructor, pues no todos han sido negativizados expresamente. Lo cual determina y hace aconsejable a nuestro parecer la procedencia y práctica de las diligencias de que se trata.
Respecto al tiempo que se indica en el razonamiento indicado “in fine” de forma que “..su práctica comporta un plazo temporal inadmisible. . “, no se comparte con la Sala, por cuanto, en primer lugar, hemos podido obtener del perito de esta parte, DR. FRONTELA CARRERAS -eminencia internacional en la materia a quien no se ha consultado al respecto (y así se solicita desde ahora, pues las anteriores consultas han sido hechas de oficio por la Sala a otros peritos)-, información al respecto que contradice la emanada de las Dras. GISBERT y ALER, en el sentido que se emplearía tres meses como máximo en dicha pericia, cualquiera que sea el número de pelos a analizar dentro de los parámetros que nos ocupan. Y, además, si se reduce el número de pelos a los más importantes en cuanto a su localización y procedencia (por ejemplo: los indicados en primer lugar de nuestro escrito de 21.11.96, folios 832 y 833: “CADÁVER 1…codo izquierdo…dos pelos de origen sexual; CADÁVER 2….un pelo de origen sexual…sobre la mano derecha…”) se podría concluir con menor coste en todos los sentidos.
Al efecto de corroborar lo antedicho, se aporta copia del escrito recibido por fax hoy mismo del perito Dr. FRONTELA que no había sido consultado, a pesar de tener una gran experiencia en la materia, en cuyo escrito se indica el tiempo máximo o “apropiado” de tres meses, es decir que podría ser aún menor y que es insignificante que sean uno que tres o más, puesto que se pueden simultanear.
TERCERO. – Sirva el presente recurso para expresar que suplicamos, con el indicado respeto, un último esfuerzo por la Sala, (comprendiendo perfectamente el celo que le guía, pero con mayor objetividad directora del proceso, si cabe), en el sentido de que puede obtenerse mas concreta verdad material que nos guíe precisamente en la causa penal en orden a efectuar su cometido cada cual lo más completa y seguramente, “con plenas garantías”, según dispone la Constitución Española; pues no estamos de acuerdo en que se trata de una dilación indebida y el objeto de la diligencia solicitada se considera de tal importancia que no debemos sustraernos a la posibilidad de sus resultados, cualquiera que fuese.
Según el criterio de prudencia que la Sala estime oportuno, se podría incluso reducir el número de pelos a analizar pues el coste no sólo se reducirá ostensiblemente sino que las partes veríamos así cumplido el propósito esclarecedor que nos guía conjugado con las pseudo-limitaciones del sistema procesal que pesan sobre nuestro quehacer técnico en el proceso.
Es decir, no puede entenderse que las pericias solicitadas no sean conducentes a un mayor esclarecimiento, si no se operan (¿o sí?). Esto parece irrebatible.
De lo contrario no precisaría su práctica. Obviamente, pues, según un criterio de prudencia, esclarecedor, deben practicarse. Estamos en momento para ello; después será ya inoperante, salvo para el resto de participantes o autores de los hechos, no obstante ser de cierta utilidad y previsión también a estos efectos, pero ello no es sede ni momento ahora para debatir.
En virtud de lo expuesto, procede y SUPLICO A LA SALA que, teniendo por presentado este escrito con documento y copias se digne admitirlo, tenga por interpuesto RECURSO DE SUPLICA contra el Auto impugnado y, previos los trámites legales, lo estime y revocándolo, acuerde la revocación del de conclusión del sumario de 4.11.96, mandando en consecuencia la práctica de la pericia de que se trata por el Dr. FRONTELA CARRERAS en el plazo de tres meses máximo, por ser de plena justicia y ajustado a Derecho.
Justicia que pido en Valencia, a 3 de diciembre de 1996
Fdo. Vicente Attard Fdo. Isabel Caudet

FOLIO 565
INSTITUTO DE MEDICINA LEGAL Y CIENCIAS FORENSES – SEVILLA
Luis Frontela Carreras, Catedrático de Medicina Legal, en relación a la petición efectuada por el Letrado D. Vicente Attard Torró, respecto a la pericia de realizar el análisis de AND mitocondrial, tanto en un pelo, como en veintiuno, según se había solicitado por las acusaciones en el Sumario 1/93, procedente del Juzgado de Instrucción de Alcira, cabe por este perito informar que, según el estado actual de la ciencia, en un laboratorio adecuado y llevado a efecto por especialistas competentes, se emplearía un tiempo aproximado, en la realización de dicha pericia, de tres meses.
Lo cual tiene el honor de informar en Sevilla a tres de diciembre de mil novecientos noventa y seis.
Fdo. Luis Frontela Carreras.

FOLIOS 1596 – 1611
ATESTADO 102/97
311ª COMANDANCIA DE LA GUARDIA CIVIL- UNIDAD ORGÁNICA POLICÍA JUDICIAL -VALENCIA DILIGENCIAS CUMPLIMENTANDO OFICIO JUDICIAL DE LA SECCIÓN 2ª DE LA AUDIENCIA PROVINCIAL DE VALENCIA, DE FECHA 26 DE MARZO DE 1997, EN RELACIÓN CON EL SUMARIO 1/93-A DEL JUZGADO DE INSTRUCCIÓN N° 6 DE ALCIRA (V).
En Valencia, en dependencias de la Unidad Orgánica de Policía Judicial de la 311ª Comandancia de la Guardia Civil, el Brigada D. Pablo Pizarro Plaza como Instructor y el Guardia Civil D. Pedro Cano Nortes como Secretario, ambos pertenecientes a las Unidades arriba indicadas extienden esta diligencia y hacen constar:
Que con fecha 6 de Abril de 1.997, se recibió en esta Unidad escrito de la Sección 2ª de la Audiencia Provincial de Valencia en el que, ” En méritos de lo acordado por la Sala en las actuaciones que se siguen contra Miguel Ricart Tárrega, se acuerda se le informe de los efectos que obren en poder de esta Unidad y en caso de que no estén custodiados en esta Comandancia, el organismo al que hayan sido remitidos”. Igualmente se interesa se ponga en conocimiento de la Sala la existencia de cualquier efecto o instrumento dimanantes de los hechos que dieron lugar al Sumario y a sensu contrario de aquellos que por cualquier circunstancias obren referenciados y no traigan causa de los hechos objeto del presente proceso.
En cumplimiento de lo acordado por la Autoridad Judicial se procede a relacionar los efectos.

DILIGENCIA HACIENDO CONSTAR LOCALIZACIÓN DE LAS ROPAS DE LAS NIÑAS
En Valencia en las Dependencias de Policía Judicial, el Instructor y Secretario extiende la presente diligencia para hacer constar que si bien es cierto que por el Guardia Civil Don. Juan Mariscal Jiménez con fecha 10 de Febrero de 1.993, se retiraron del Juzgado de Instrucción nº 6 de los de ALZIRA (Valencia) las ropas de las niñas tal como consta en la fotocopia que la Acusación Particular incluye en escrito dirigido a la Sala, estos efectos fueron retirados para analizar en el Instituto Nacional de Toxicología. En dicho Instituto se encuentran las bragas de las niñas y otros efectos pero no el resto de las ropas, tal como consta en la fotocopia que se adjunta, sin embargo hay que hacer constar que la ropa fue remitida y que posteriormente el Catedrático de Medicina Legal de Sevilla el Sr. Frontela en distintos medios de comunicación y varias veces ha hecho alusión al mal estado en el que le fueron entregadas las ropas de las niñas, por ello se deduce que es el Catedrático Sr. FRONTELA quien al parecer debe de tenerlas en su haber o bien saber el destino que le dio, pues en esta Unidad no existe documento o recibo alguno deldepósito de las mismas.
CONSTE y CERTIFICO.

FOLIOS 1626 – 1637
Folio 1626 – Carátula de fax del INT a la Audiencia Provincial -Sección 2ª
Ministerio de Justicia – Instituto Nacional de Toxicología
Fecha – 24 -4-97
N/Ref. 345-6-7/93
S/Ref. Sumario 1/93
EXCMO. SR. PRESIDENTE AUDIENCIA PROVINCIAL SECC 2ªVALENCIA
En contestación a su oficio de fecha 17-4-97. le adjunto relación detallada de las muestras recibidas en este Centro, correspondientes al Sumario n° 1/93 del Juzgado de Instrucción n° 6 de Alcira (Valencia), desglosándolas según los diferentes envíos realizados y con indicación de si se conservan en custodia o I fueron remitidas a algún otro laboratorio y en este caso se h’1dica así mismo el destino.
Madrid. 24 de abril de 1997
EL DIRECTOR DEL DEPARTAMENTO ILMO. SR. PRESIDENTE. AUDIENCIA PROVINCIAL SECC. 2ª. VALENCIA..
Ministerio de Justicia – Instituto Nacional de Toxicología
INFORME Nº 345/93:
1º ENVÍO: 29-1-93:
Traído por la Guardia Civil, una caja con una nevera y una bolsa. conteniendo 8 muestras:
M-1: Bote con piel cara posterior del codo izdo. en formol.
M-2: Bote con fragmento cutáneo del dorso de la mano derecha.
M-3: Bote con mano izquierda en formol.
M-4: Bote con mano derecha en formol.
M-5: Bote con periné en formol.
M-6: Caja con cráneo.
M-7: Bolsa con braga con pelos.
M-8: Bolsa conteniendo alfombra color marrón oscuro (muestra común para los tres informes).
Estas muestras correspondientes al 1º envío, fueron remitidas a la Cátedra de Medicina Legal de Sevilla, a la atención del Dr. Luis Frontela el día 17 de septiembredo 1993, con excepción de la muestras n° 6 (caja con cráneo) que fue remitida el 24 de septiembre de 1993.
11º ENVÍO: 11-1-95:
Traído por correos, procedente de la Cátedra de Medicina Legal de Sevilla. un paquete conteniendo:
M-1: Cinco portas conteniendo cinco pelos.
M-2: Porta con 3 pelos obtenidos del sostén.
Porta con 2 pelos obtenidos del sostén.
Porta con 2 pelos obtenidos del sostén.
M-3: Porta con 1 pelo obtenido del jersey.
Porta con 3 pelos obtenidos del jersey.
Porta con 1 pelo obtenido del jersey.
Porta con 3 pelos obtenidos del jersey.
Porta. con 1 pelo obtenido del jersey.
Porta con 2 pelos obtenidos del jersey..
M-4: Porta con 2 pelos obtenidos del resto de la ropa.
Porta con 1 pelo obtenido del resto de la ropa.
Porta con 3 pelos obtenidos del resto de la ropa.
M-5 Porta con un pelo prendido en la ligadura,
M-6: Porta con 4 pelos obtenidos de las botas.
Estas muestras, pertenecientes al 11º envío, fueron remitidas a la Cátedra de Medicina Legal de Sevilla, a la atención del Dr. Luis Frontela. el día 14 de julio de 1995.
Se conservan a -80ºC, 18 extractos de ADN, negativo para ADN nuclear, procedentes de la raíz de 18 pelos dubitados entregados por la sección de Criminalística.
INFORME Nº 346/23:
1º ENVÍO: 29-1-93:
Traído por la Guardia. Civil, una caja con una nevera y una bolsa, conteniendo 10 muestras,
M-l: Bote con mano derecha en formol.
M-2: Bote con rodilla izquierda en formol.
M.3: Bote con contenido rectal.
M-4: Bote con frotis vaginal.(Porta).
M-5: Bote con periné en formol.
M-6: Bote con material en fondo de saco vaginal en formol.
M-7: Bote con material en fondo de saco vaginal en seco.
M-8: Bote con zona del pezón en formol.
M-9: Bolsa con braga con pelos.
M-10: Caja con cráneo
La Muestra n° 7, (bote con material en fondo de saco vaginal en seco) fue agotada en el transcurso de los análisis. Estas muestras correspondientes al 1º envío, fueron remitidas a la Cátedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela el día 17 de septiembre de 1993.
11º ENVÍO: 11-1-95:
Traído por correos, procedente de la Cátedra de Medicina Legal de Sevilla un paquete conteniendo:
M-1: Tres portas con un pelo cada uno de la cabeza.
M-2: Un porta con 2 pelos obtenidos del resto de la ropa.
M-3: Dos portas con un pelo cada uno obtenidos de la cazadora.
M-4: Dos portas con un pelo cada uno obtenidos de las botas.
M-5: Un porta con 2 pelos obtenidos del sostén.
M-6: Un porta con tres pelos obtenidos de la braga.
M-7: Un porta con un pelo prendido en el cinturón del pantalón.
Estas muestras, pertenecientes al 11º envío, fueron remitidas a la Cátedra de Medicina Legal de Sevilla, a la atención del Dr. Luis Frontela, el día 14 de julio de 1995, con excepción de la muestras n° 7 (pelo prendido en el cinturón del pantalón), que fue remitida el día 8 de julio de 1996, a la cátedra de medicina legal de Valencia.
Se conservan a -80ºC, 4 extractos de ADN, negativo para ADN nuclear, procedentes de la raíz de 18 pelos dubitados entregados por la sección de Criminalística.
INFORME Nº 347/23:
1º ENVÍO: 29-1-93:
Traído por la Guardia Civil, una caja, con una nevera y una bolsa, conteniendo 11 muestras:
-M-1: Un bote con fragmento de rodilla izquierda en formol
-M-2: Un bote con mano izquierda en formol
-M-3: Un bote con liquido en cavidad torácica (sangre)
-M-4: Un bote con vesícula biliar
-M-5: Un bote con hallazgo en contenido de estómago
-M-6: Un bote con estómago
-M-7: Un bote con periné en formol
-M-8: Un bote con contenido rectal
-M-9: Un bote con contenido vaginal
-M-10: Una caja con cráneo .
-M-11: Una bolsa con bragas (En esta caja del cadáver nº 3, vienen 2 bragas reseñadas y numeradas como a continuación: Bolsa nº 1: cadáver nº 3 (braga roja), Bolsa n° 2: cadáver nº 2 (braga blanca); consideramos que las dos bragas corresponden al cadáver nº 3).
Estas muestras correspondientes al 1º envío, fueron remitidas a la Cátedra de Medicina Legal de Sevilla, a la atención del Dr. Luis Frontela, el día 17 de septiembre de 1993, con excepción de la muestra nº 9 (bote con contenido vaginal), fue agotada en el transcurso de los análisis.
11º ENVÍO: 11-1-95:
Traído por correos, procedente de la Cátedra de Medicina Legal de Sevilla un paquete conteniendo:

M-l: Porta con dos pelos obtenidos de la braga roja. .
M-2: Porta con un pelo obtenido del sostén.
M-3: Porta con un pelo obtenido de la camiseta
Porta con un pelo obtenido de la camiseta.
Porta con un pelo obtenido de la camiseta
Porta con un pelo obtenido de la camiseta
M-4; Porta con un pelo obtenido del resto
Porta con un pelo obtenido del resto de la ropa..
Porta con un pelo obtenido del resto de la ropa.,
Porta con un pelo obtenido del resto de la ropa..
Porta con un pelo obtenido del resto de la ropa,.
Porta con un pelo obtenido del resto de la ropa..
M-5: Porta con un pelo do la cabeza.
Porta con un pelo de la cabeza.
Porta con un pelo de la cabeza.
Estas muestras, pertenecientes al 11º envío, fueron remitidas a la Cátedra de Medicina Legal de Sevilla. a la atención del Dr. Luis Frontela, el día 14 de julio de 1995.
Se conservan a -80ºC., 7 extractos de ADN, negativo para ADN nuclear, procedentes de la raíz de 18 pelos dubitados entregados por la sección de Criminalística.
MUESTRAS COMUNES A LOS TRES INFORMES:
2° ENVÍO: 10-2-93:
Traído por la Guardia Civil. 6 cajas y un sobre. conteniendo:
Caja n° 1, de 1,200 kgrs. y de 31x24x.18 cms. conteniendo:
3-F: 2 cuerdas de fibra sintética de color negro.
4-F: 2 cuerdas de fibra sintética de color negro con lazo doble con nudo fijo.
5-F: Vértebra.
6-F: 2 huesos.
8-F: Vértebra.
9-F: Restos de tejidos.
10-F: Restos de fibras.
11-F: Pelos encontrados en e1 interior de la fosa.
12-F: 2 muestras de fragmentos de huesos.
14-F: Restos de papel o tejido,
16-F: Restos de fibra textil y otra sintética.
18-F: Piedra.
21-F: Trozo de materia ósea.
1-S: Pelos del colchón.
2-S: Pelo del colchón.
4-S: Venda.
12-S: Fibras de la funda del colchón.
14-S: Venda de color blanco.
15-S: Venda de color blanco.
18-S: Pelos recogidos sobre el colchón.
22-S: Pelos recogidos del colchón de espuma y trozo de espuma.
23-S: Trozo de madera.
24-S: Cuerda negra de fibra sintética.
26-S: Navaja cromada con hoja de 2,5cm.
1-E: Venda blanca.
D-1: Tapizado Opel Corsa.
D-2: Balleta recogida del Opel Corsa.
D-3: Tapicería asiento derecho Opel Corsa.
Muestras recogidas en OPEL CORSA:
Nº 1: Pelos. Nº 2: Pelos. Nº 3: Pelos, Nº 4: Pelos. Nº 5: Sustancia con pelos adheridos. Nº 6: Pelos. Nº 7: Pelos. Nº 8: Pelos. Nº 9: Pelos. Nº 10: Pelos. Nº 11: Pelos. Nº 12: Pelos. Nº 13: Pelos. Nº 14: Pelo recogido de un cepillo.
Muestras recogidas con aspiradora en el interior del vehículo:
– Nº 15, 16, 17, 18 y 19.
– Nº 20: Esponja usada como filtro en la aspiradora.
Muestras obtenidas del coche SEAT RONDA:
C-1: Pelo. C-2: Pelo. C-3: Pelo. C-4: Pelo. C-5: Pelo. C-7: Pelos. C-8: Pelos. C-9: Pelos. C-10: Pelos.
Muestras recogidas con aspirador:
C-11 y C-12.
-De las muestras señaladas en negrilla, permanecen en custodia en este Instituto. por un periodo de 10 años, los tallos de los pelos.
-También de dichas muestras, así como de las recogidas en “Opel Corsa” y “Seat Ronda”, a excepción de la muestra n° 11-F (pelos encontrados en el interior de la fosa), se conservan 158 extractos de ADN a -80°C. negativos para ADN nuclear, procedentes de 158 pelos entregados por la sección de Criminalística.
.- El resto, fueron devueltas a la Cátedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela, el día 17 de septiembre de 1993, con excepción de uno de los dos huesos de la muestra n° 6-F, que fue agotado en el transcurso de los análisis.
Muestras de autopsia:
3-C: Pelo de cabello de MIRIAM GARCÍA IBORRA
3-P: Pelo de pubis de MIRIAM: GARCÍA IBORRA
1-C: Pelo cabello de ANTONIA GÓMEZ RODRÍGUEZ.
1-P: Pelo de pubis de ANTONIA GÓMEZ RODRÍGUEZ.
2-P: Pelo de pubis de DESIRÉE HERNÁNDEZ FOLCH.
2-C: Pelo de cabello de DESIRÉE HERNÁNDEZ FOLCH.
Muestras de los detenidos:
Nº 23: Pelos de pubis de ENRIQUE ANGLÉS MARTÍNS,
Nº 24: Pelos de cabeza de ENRIQUE ANGLÉS MARTÍNS.
Nº 25: Pelos de cabeza de MIGUEL RICART TÁRREGA.
Nº 26: Etiquetada como pelos de pubis de ENRIQUE (Suponemos que es error, ya que en la relación de muestras viene reseñada la muestra 26 como pelos de pubis de MIGUEL RICART TÁRREGA.
Nº 27: Etiquetada como pelos de cabeza de LUIS RIBERA GALLARDO.(En la relación de muestras viene como pelos de pubis.)
Nº 28: Etiquetada como pelos de pubis de LUIS RIBERA GALLARDO (En la relación de muestras viene como pelos de cabeza.)
Nº 29: Pelos de pubis de ROBERTO ANGLÉS MARTÍNS.
Nº 30: Pelos de cabeza de ROBERTO ANGLÉS MARTÍNS.
– Las muestras señaladas en negrilla fueroon remitidas a la Cátedra de Medicina Legal de Santiago de Compostela, a la atención del Profesor Carracedo.
– De las muestras n° 23. 24. 27. 28, 29 y 30, se conservan extractos de ADN de cada una de ellas a -80ºC.
-Las demás, así como los restos de la 23, 24, 27,28, 29 y 30, fueron devueltas a la Cátedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela el día 21 de abril de 1997.
Muestras obtenidas en el interior de la caseta, planta baja:
Nº 19-B: Raspaduras obtenidas en la pared.
Muestras obtenidas en la explanada, a unos 50mts. de la fosa:
1-X: Venda de color blanco.
CAJA Nº 2 de 2,100 kgrs. y de 30x24x30 cms. conteniendo:
Muestra obtenida en el interior de la caseta. Planta superior:
20.S: Sábana.
21.S: Manta.

CAJA Nº 3 de 1 kgrs. y de 30x24x30 cms:
Muestra obtenida en las proximidades de la caseta:
2-P: Toalla.

CAJA Nº 4 de 1.790 kgrs. y de 30x24x30 cms.:
Muestras del Opel Corsa:
Bolsa D-4: Tapicería parte posterior del vehículo.
Bolsa D-4: Tapicería asiento posterior del vehículo.
CAJA Nº 5 de 1,626 kgrs. y de 45x18x28 cms.:
Muestra obtenida en el corral:
7-A: Funda de colchón azul.
Muestra obtenida en Opel Corsa:
Nº 28. Alicates.
Muestra obtenida del Seat Ronda:
C-13: Hacha.
CAJA Nº 6 de 5,400 kgrs. y de 95x28x3 7 cms:
20-F: Tablas de madera atado con cuerda.
Bolsa negra con la etiqueta de “otros objetos”.
Cazadora beige.
Camiseta blanca.
Sobre: Conteniendo:
Una fotografía.
Un poster con fotografías de los cadáveres.
4 tarjetas con fotografías de los cadáveres.
– Estas muestras fueron devueltas a la Cáttedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela el día 17 de septiembre de 1993. Además de la muestra n° 7-A se conservan restos sobrantes tras el análisis de ADN con manchas de sangre, así como sus extractos de ADN. También se conservan extractos de ADN obtenidos de los restos de esperma detectados en dicha muestra.
3° ENVÍO: 12-2-93:
Traído por la Guardia Civil, una caja de 16.200 kgrs. y de 68x41x37 cms., conteniendo:
Bolsa n° 1:
Par de zapatos negros con cordones.
Par de zapatos negros con flecos y hebilla.
Par de botas marrones.
Bolsa. n° 1: Ataduras.
Bolsa n° 2: Ataduras manos.
Bolsa n° 3: Cadena con colgante (Ref. 1985-4).
Bolsa n° 2. (cadáver n° 1): Dos calcetines morados con combos verdes y azules.
Ref. 1986-11: Camiseta
Ref. 1986-16: Prenda de punto “OKAPI”
Ref. 1986-12: Sujetador.
Ref. 1986-15: Pantalón “CAROCHE” con cinturón.
Bolsita con trozos de tela.
Bolsa nº 3: (1987-Miriam):
Pulsera con 9 piedras cilíndricas de colores.
Ref. 1987-7: Sujetador.
Ref.1987-18: Camiseta.
Ref. 1987-21: Cazadora vaquera.
Ref. 1987-19: Pantalón vaquero.
Bolsita con recortes de tela del pantalón (Ref. 1987).
Bolsa n° 4: (Bolsa etiquetada como cadáver n° 2 Desirée (1985)).
Bolsita con recortes de tela (Ref. 1985 pantalón).
Ref. 1985-16: Pantalón con cinturón.
Ref. 1985-17: Sujetador.
Ref. 1985-18: Cazadora de cuero.
Ref. 1985-14: Camiseta.
4° ENVÍO: 18-2-93:
Traído por la Guardia Civil de Madrid, un sobre conteniendo:
Un tubo con liquido reseñado como 19-B.
5° ENVÍO: 12-3-93:
Traído por la Guardia Civil, una caja de 1 kgrs. y de 22x17x16 cms. conteniendo:
Bolsa n° 1:
Papel higiénico.
Bolsa n° 2:
Toalla rizo blanquecina.
Toalla blanquecina.
Las muestras señaladas en negrilla fueron agotadas en el transcurso de los análisis
El resto, fueron devueltas a la Cátedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela el día 17 de septiembre de 1993.
De la muestra de papel higiénico (5° envío) bolsa nº 1), se conservan restos con manchas de sangre y sus extractos de ADN.
6° ENVÍO: 2-4-93:
Traído por la Guardia Civil del Centro de Investigación y Criminalística, un sobre, conteniendo:
Un sobre etiquetado con el n° 27 conteniendo cuatro pelos humanos encontrados en el interior del guante.
Un sobre conteniendo cinco pelos humanos encontrados en tierra procedente de la fosa.
Sobre conteniendo tres pelos humanos encontrados en el interior del guante etiquetado como n° l-A.
Estas muestras permanecen en custodia en este Instituto por un periodo de 10 años.
7º ENVÍO: 14-7-93:
Recibido por la agencia Gómez, una nevera conteniendo:
Un tubo con sangre perteneciente a NEUSA MARTÍNS DÍAS.
El hemolizado de esta muestra y los extractos de ADN. permanece en custodia en este centro a -80ºC. El resto, fueron devueltas a la Cátedra de Medicina
Legal de Sevilla a la atención del Dr. Luis Frontela el día 31 de octubre de 1994.
8º ENVÍO 16-7-93:
Tres tubos con sangre pertenecientes a Miguel Ricart.
Los hemolizados de esta muestra y los extractos de ADN, permanece en custodia en este centro a -80°C.
El resto, fueron devueltas a la Cátedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela el día 31 de octubre de 1994.
9° ENV10: 19-11-93:
Traído por la Guardia Civil, un sobre conteniendo:
Bolsa 1-P: Conteniendo .pelos de pubis de RAMÓN ANTONIO LOSA RAGA
Bolsa 2-P: Conteniendo pelos de pubis de JOAQUÍN MAURICIO ANGLÉS MARTÍNS.
Bolsa 3-P: Conteniendo pelos de pubis de JOSÉ MIGUEL MARTÍNEZ CANA
Bolsa 1-C: Conteniendo pelo de cabeza de RAMÓN ANTONIO LOSA RAGA
Bolsa 2-C: Conteniendo pelos de la cabeza de JOAQUÍN MAURICIO ANGLÉS MARTÍNS.
Bolsa 3-C: Conteniendo pelos de la cabeza de JOSÉ MIGUEL MARTÍNEZ CANA
Estas muestras, fueron devueltas a la Cátedra de Medicina Legal de Sevilla a la atención del Dr. Luis Frontela el día 23 de febrero de 1995.

10º ENVÍO: 5-12-94
Traído por Agencia Teisa una nevera conteniendo:
M-1: Cinco tubos con sangre de JOAQUÍN MAURICIO ANGLÉS MARTÍNS.
M-2: Bote conteniendo pelos del pubis de JOAQUÍN MAURICIO ANGLÉS MARTÍNS.
M-3: Bote conteniendo pelos de la cabeza de JOAQUÍN MAURICIO ANGLÉS MARTÍNS.
De la muestra nº 1, se conservan hemolizados, así como sus extractos de ADN.
Las muestras n° 2 y 3, se conservan en este Instituto por un período de 10 años.

FOLIOS 1939 – 19>66
UNIVERSIDADE DE SANTIAGO DE COMPOSTELA
Instituto de Medicina Legal
INFORME 51/97
INFORMACIÓN
Por decisión de La Audiencia Provincial Sección Segunda de Valencia y en relación al sumario 1-93 (Alzira-6) han sido enviadas, por diferentes entidades, a este Instituto una serie de muestras de pelos y sangre que se relacionan a continuación, con la solicitud de comparar la secuencia de ADN mitocondrial de Miguel Ricart Tárrega con diversas muestras de pelos.
RELACIÓN DE MUESTRAS ENVIADAS A ESTE INSTITUTO DE MEDICINA LEGAL
Han sido remitidas a este Instituto de Medicina Legal las siguientes muestras:
PRIMERO.-
MUESTRA DE SANGRE DE MIGUEL RICART TÁRREGA
El día 14 de marzo de 1997 a las 9 horas y 30 minutos D. Tomás Villalta Jiménez con D.N.I. 70XXX trae personalmente una nevera precintada con el cuño de el Juzgado de primera Instancia e Instrucción de Manzanares que contenía un tubo de sangre rotulado con el nombre de Miguel Ricart Tárrega.
SEGUNDO.-
MUESTRAS REMITIDAS POR EL INSTITUTO NACIONAL DE TOXICOLOGÍA DE MADRID
El día 17 de marzo de 1997 se recibieron las siguientes muestras enviadas por el Instituto Naciona1 de Toxico1ogía de Madrid:
-Una bolsa con referencia al informe 345-66-7/93 (foto 1) que contenía:
2 bolsas con cabellos y vellos púbicos de Miguel Ricart Tárrega (roto 2) rotulados como:
Muestras n° 25.-
25.4.- Cabello de Miguel Ricart (foto 3)
25.5.- Cabello de Miguel Ricart (foto 4)
25.7.- Cabello de miguel Ricart (foto 5)
Muestras n° 26.-
26.5.-Vello púbico de Miguel Ricart (foto 6)
26.6. -Vello púbico de Miguel Ricart (foto 7)
26.7.-Vello púbico de Miguel Ricart (foto 8)
26.8 . -Vello púbico de Miguel Ricart (foto 9)
26.10.-Vello púbico de Miguel Ricart (foto 10)
26.11.-Vello púbico de Miguel Ricart (foto 11)
26.12.-Vello púbico de Miguel Ricart (foto 12)
26.13.-Vello púbico de Miguel Ricart (foto 13)
-Dos bo1sas (foto 14) que contenían:
Dos pelos recogidos en el codo izquierdo del cadáver n° 1 (foto 15).
Un pelo recogido en la mano derecha del cadáver n° 2 (foto 16)
Folios 1943 – 1947 – Fotos de pelos de la 11 a la 16
TERCERO.-
MUESTRAS ENVIADAS POR EL PROFESOR FRONTELA DEL DEPARTAMENTO DE MEDICINA LEGAL DE LA FACULTAD DE MEDICINA DE SEVILLA:
El dia 25 de marzo de 1997 fueron recibidos en este Instituto y enviados por el Profesor Frontela (Departamento de Medicina Legal de Sevilla), las siguientes muestras:
-5 bolsas de plástico con portas envueltos en papel (foto 17) rotulados como.-
-345/93 Jersey cadáver 1, M 3 (1 al 11 y 3′). Contenía 12. portas con pelos rotulados como:
M3-1 (foto 18)
M3-2 (foto 19)
M3-3 (foto 20)
M3-4 (foto 21)
M3-5 (foto 22)
M3-6 (foto 23)
M3-7 (foto 24)
M3-8 (foto 25)
M3-9 (foto 26)
M3-10 (foto 27)
345/93. Cadáver 1, jersey 4 (foto 28)
M3-3′(foto 29).
-346/93 Cadáver 2- M-4 ( 1 al 2). Contenía dos portas con cabellos rotulados como:
M-4.- Zapato 1 (foto 30)
M-4, 2 (foto 31)
-346/93 Cadáver 2, M-6 (1 al 3). Contenía 3 portas con cabellos rotulados como:
M-6,1 (foto 32)
M-6,2 (foto 33)
M-6,3 (foto 34)
-347/93 Cadáver 3, M-1 (1 al 2). Contenía dos portas con cabellos rotulados como:
M-1,1 (foto 35)
M-1, Braga Roja 2 (foto 36)
-247/93 Cadáver 3, M-4 cabellos (1 al 6). Contenía 6 portas con cabellos
M-4,1 (foto 37)
M-4, Ropa 2 (foto 38)
M-4, Ropa 3 (foto 39)
M-4,4 (foto 40)
M-4,5 (foto 41)
M-4,6 (foto 42)
Folios 1950 – 1958 – Fotos de pelos de la 17 a la 42.
DE TODAS ESTAS MUESTRAS ENVIADAS , LA AUDIENCIA PROVINCIAL SECCIÓN SEGUNDA DE VALENCIA NOS SOLICITA EL ANÁLISIS DE ADN MITOCONDRIAL DE LAS SIGUIENTES MUESTRAS.
Muestra nº 3 del apartado 36°
-Vello de tipo púbico de 51mm. de longitud y de 125 micras de diámetro máximo, tiene fuxia en el extremo proximal y médula continua de tipo visible, la raíz esta en fase telógena- (encontrado en el cadáver n° 1).- (página 70 del informe).
Muestra n° 4 del apartado 37°
-Vello de color rubio con la raíz en fase telógena (encontrado en el cadáver nº 2).- (página 71 del informe).
Muestra nº 6 del apartado 37°
-Tres vellos; uno tiene la raíz en fase anágena; otro presenta ruptura postmorten del tallo y el último carece de raíz por estar roto o cortado.-
(encontrados en el cadáver n° 2).- página 71 del informe
Muestra nº 1 del apartado 38°
-Dos vellos; de color castaño oscuro presenta ruptura postmorten del extremo proximal del tallo; el de color rubio tiene raíz en fase telógena.- (encontrados en el cadáver n° 3).- (página 72 del informe)
Muestra n° 4 del apartado 38°
-Cinco vellos; tres de los vellos tienen raíces en fase telógena, uno catágena con desprendimiento postmorten y otro presenta. ruptura postmorten del tallo.- (encontrado en cadáver n° 3).- (página 72 del informe).
Muestras del detenido n° 25 y nº 26, -cabellos y vellos púbicos de Miguel Ricart Tárrega- (página 3 del informe).
Dos pelos de origen sexual encontrados en la cara posterior del codo izquierdo del cadáver nº 1
Un pelo de origen sexual encontrado en la mano derecha del cadáver n° 2.
El informe al que se hace referencia en las peticiones es el informe del Instituto Nacional de Toxicología emitido el 4 de marzo de 1993 (hojas XXVII y XVIII).
MÉTODO DE ANÁLISIS
1.-Extracción de ADN
La extracción de ADN de las muestras se realizó mediante un método de fenol-cloroformo seguido de concentración con microcon 100.
2.- Amplificación y secuenciación de mtDNA
Amplificación por PCR de la región control del mtDNA
Se han empleado los siguientes iniciadores – (primers), realizando el protocolo de amplificación según las referencias señaladas. (1,2,3)
PRIMERS REGIÓN CONTROL
.L15997 5′ CACCATTAGCACCCAAAGCT’ 3′
.H408 5′ CTGTTAAAAGTGCATACCGCCA3′
El producto amplificado obtenido se ha comprobado en minigeles de poliacrilamida con gradiente de concentración 8/25, con posterior visualización mediante tinción argéntica, según protocolo descrito por Barros.
(4)
Asimismo, se han empleado controles negativos y positivos en cada análisis realizado.
Nested-PCR de la región hipervariable HV1
Se ha realizado la amplificación de la región control para la zona hipervariable HV1, empleando los iniciadores descritos a continuación, y siguiendo el protocolo descrito en las referencias (2). También en este caso se han empleado controles negativos y positivos.
PRIMER DE LA REGIÓN HIPERVARIABLE HV1
Estudio de la cadena H:
Primers para la amplificación:
L15997 5′ CACCATTAGCACCCAAAGCT’3′
H16401 5’TGATTTCACGGAAGGATGGTG 3
Primer para la secuenciación
H16401 F- 5’TGATTTCACGGAAGGATGGTG 3
Secuenciación cíclica mediante secuenciador automático (ALF- Pharmacia, UPEsala, Suecia)
Se han secuenciado todas las muestras, para la zona hipervariable 1 (HV1).
Comparación de resultados
Las secuencias obtenidas son comparadas con la secuencia “Anderson” (5) de referencia. Se comunican únicamente variaciones respecto a dicha secuencia control.
Otras consideraciones en relación con el análisis de ADN mitocondrial
Al ser de muy reciente introducción en el campo forense el análisis de ADN mitocondrial no está actualmente incorporado a controles de calidad nacionales e internacionales. Sin embargo el uso de ADN mitocondrial ha sido validado para uso forense (3) y ha sido estandarizado su uso por la EDNAP (Europea DNA Profiling Group) (Bruselas, Marzo, 1997) Se disponen, asimismo, de frecuencias de HV1 en poblaciones españolas.
Referencias:
1.-Hopgood R, Sullivan KM, Gill P (1992) : Strategies for automated Sequencing of Hurnan Mitocondrial ONA directly from PCR products. Biotechniques 14(1): 82-92.
2.-Sullivan KM, Hopgood R y Gill P (1992) ídentification of human remains by amplification and automated sequencing of mitocondrial DNA. International Journal of Legal Medicine 105:83-86.
3.-Wilson MR, DiZinno JA, Polanskey D, Reploge J, Budowle B. (1995) :
Validation of mitochondrial DNA sequencing for forensic casework analysis.
International Journal of Legal Medicine, 108:68-74.
4.- Barros F, Lareu MV y Carracedo A. (1992) Detection of polyrnorphisms of hurnan DNA after PCR by miniaturized SOS- polyacrylamide gel electrophoresis. Forensic Science International,55:27-36.
5.- Anderson S, Baker AT, Barrell BG, de Brujin MHL, Coulson AR, Orouin
J, Eperin lC, Nierlich OP, Roe BA, Sanger F, Scheier PH, Smith AJH, Staden
R, Young IG (1981). Sequence and organization of the human mitochondrial genome. Nature, 290: 457-465.

CONCLUSIONES
PRIMERA.- Todas las muestras solicitadas por la Audiencia Provincial de Valencia han sido analizadas a excepción de los pelos pertenecientes a Miguel Ricart Tárrega debido a que el estudio del ADN mitocondrial se realizó en la sangre del mismo.
SEGUNDA. – En tres de los pelos analizados, los rotulados como M-3,3′; M-4 zapato 1; y uno de los pelos recogidos en el codo izquierdo del cadáver número 1, la amplificación de ADN mitocondrial ha dado resultados negativos, por la que la secuencia no pudo ser obtenida.
TERCERA.- El resto de los pelos analizados la amplificación ha dado resultados positivos, obteniéndose las secuencias correspondientes de ADN mitocondrial.
CUARTA.- La secuencia de ADN mitocondrial obtenida de la sangre de Miguel Ricart Tárrega presenta una variación en la posición 16298 donde cambia una C por una T con respecto a la secuencia Anderson de referencia.
QUINTA.- Ninguna de las secuencias de ADN mitocondrial obtenidas de los pelos analizados coinciden con la secuencia de ADN mitocondrial obtenida de la Sangre de Miguel Ricart Tárrega, por lo que se puede afirmar que ninguno de dichos pelos pertenecían a Miguel Ricart Tárrega.
En Santiago a 30 de Abril de 1997
Fdo. Prof. Dr. Ángel Carracedo Fdo. Profa. Dra. Mª Victoria Lareu

comentarios

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s