Informe del profesor Carracedo

FOLIO 1938
UNIVERSIDADE DE SANTIAGO DE COMPOSTELA
Instituto de Medicina Legal – San Francisco. s/n -15705
Santiago de Compostela Galicia – España – Tel. 34-81-582327. Fax 34-81-580336 Homepage http://www.usc.es/imlus/
Audiencia Provincial Sección Segunda Valencia
SUMARIO 1/93– Alcira 6


Ilmos. Sres.:
Adjunto les remito el informe pericial solicitado. No duden en consultar cualquier duda o aclaración que tengan sobre el mismo.
En Santiago a 2 de Mayo de 1997
Fdo. Prof. Ángel Carracedo
Instituto de Medicina Legal de Santiago de Compostela
Director
FOLIOS 1939 – 19>66
UNIVERSIDADE DE SANTIAGO DE COMPOSTELA
Instituto de Medicina Legal
INFORME 51/97


INFORMACIÓN

Por decisión de La Audiencia Provincial Sección Segunda de Valencia y en relación al sumario 1-93 (Alzira-6) han sido enviadas, por diferentes entidades, a este Instituto una serie de muestras de pelos y sangre que se relacionan a continuación, con la solicitud de comparar la secuencia de ADN mitocondrial de Miguel Ricart Tárrega con diversas muestras de pelos.

RELACIÓN DE MUESTRAS ENVIADAS A ESTE INSTITUTO DE MEDICINA LEGAL
Han sido remitidas a este Instituto de Medicina Legal las siguientes muestras:

PRIMERO.-
MUESTRA DE SANGRE DE MIGUEL RICART TÁRREGA
El día 14 de marzo de 1997 a las 9 horas y 30 minutos D. Tomás Villalta Jiménez con D.N.I. 70XXX trae personalmente una nevera precintada con el cuño de el Juzgado de primera Instancia e Instrucción de Manzanares que contenía un tubo de sangre rotulado con el nombre de Miguel Ricart Tárrega.

SEGUNDO.-
MUESTRAS REMITIDAS POR EL INSTITUTO NACIONAL DE TOXICOLOGÍA DE MADRID
El día 17 de marzo de 1997 se recibieron las siguientes muestras enviadas por el Instituto Naciona1 de Toxico1ogía de Madrid:

-Una bolsa con referencia al informe 345-66-7/93 (foto 1) que contenía:
2 bolsas con cabellos y vellos púbicos de Miguel Ricart Tárrega (roto 2)
rotulados como:

Muestras n° 25.-
25.4.- Cabello de Miguel Ricart (foto 3)
25.5.- Cabello de Miguel Ricart (foto 4)
25.7.- Cabello de miguel Ricart (foto 5)

Muestras n° 26.-
26.5.-Vello púbico de Miguel Ricart (foto 6)
26.6. -Vello púbico de Miguel Ricart (foto 7)
26.7.-Vello púbico de Miguel Ricart (foto 8)
26.8 . -Vello púbico de Miguel Ricart (foto 9)
26.10.-Vello púbico de Miguel Ricart (foto 10)
26.11.-Vello púbico de Miguel Ricart (foto 11)
26.12.-Vello púbico de Miguel Ricart (foto 12)
26.13.-Vello púbico de Miguel Ricart (foto 13)
-Dos bo1sas (foto 14) que contenían:
Dos pelos recogidos en el codo izquierdo del cadáver n° 1 (foto 15).
Un pelo recogido en la mano derecha del cadáver n° 2 (foto 16)
Folios 1943 – 1947 – Fotos de pelos de la 11 a la 16

TERCERO.-
MUESTRAS ENVIADAS POR EL PROFESOR FRONTELA DEL DEPARTAMENTO DE MEDICINA LEGAL DE LA FACULTAD DE MEDICINA DE SEVILLA:
El dia 25 de marzo de 1997 fueron recibidos en este Instituto y enviados por el Profesor Frontela (Departamento de Medicina Legal de Sevilla), las siguientes muestras:

-5 bolsas de plástico con portas envueltos en papel (foto 17) rotulados como.-
-345/93 Jersey cadáver 1, M 3 (1 al 11 y 3′). Contenía 12. portas con pelos rotulados como:

M3-1 (foto 18)
M3-2 (foto 19)
M3-3 (foto 20)
M3-4 (foto 21)
M3-5 (foto 22)
M3-6 (foto 23)
M3-7 (foto 24)
M3-8 (foto 25)
M3-9 (foto 26)
M3-10 (foto 27)

345/93. Cadáver 1, jersey 4 (foto 28)
M3-3′(foto 29).

-346/93 Cadáver 2- M-4 ( 1 al 2). Contenía dos portas con cabellos rotulados como:
M-4.- Zapato 1 (foto 30)
M-4, 2 (foto 31)

-346/93 Cadáver 2, M-6 (1 al 3). Contenía 3 portas con cabellos rotulados como:
M-6,1 (foto 32)
M-6,2 (foto 33)
M-6,3 (foto 34)

-347/93 Cadáver 3, M-1 (1 al 2). Contenía dos portas con cabellos rotulados como:
M-1,1 (foto 35)
M-1, Braga Roja 2 (foto 36)

-247/93 Cadáver 3, M-4 cabellos (1 al 6). Contenía 6 portas con cabellos
M-4,1 (foto 37)
M-4, Ropa 2 (foto 38)
M-4, Ropa 3 (foto 39)
M-4,4 (foto 40)
M-4,5 (foto 41)
M-4,6 (foto 42)
Folios 1950 – 1958 – Fotos de pelos de la 17 a la 42.

 

DE TODAS ESTAS MUESTRAS ENVIADAS , LA AUDIENCIA PROVINCIAL SECCIÓN SEGUNDA DE VALENCIA NOS SOLICITA EL ANÁLISIS DE ADN MITOCONDRIAL DE LAS SIGUIENTES MUESTRAS.

Muestra nº 3 del apartado 36°
-Vello de tipo púbico de 51mm. de longitud y de 125 micras de diámetro máximo, tiene fuxia en el extremo proximal y médula continua de tipo visible, la raíz esta en fase telógena
– (encontrado en el cadáver n° 1).- (página 70 del informe).

Muestra n° 4 del apartado 37°
-Vello de color rubio con la raíz en fase telógena (encontrado en el cadáver nº 2).- (página 71 del informe).

Muestra nº 6 del apartado 37°
-Tres vellos; uno tiene la raíz en fase anágena; otro presenta ruptura postmorten del tallo y el último carece de raíz por estar roto o cortado.
– (encontrados en el cadáver n° 2).- página 71 del informe

Muestra nº 1 del apartado 38°
-Dos vellos; de color castaño oscuro presenta ruptura postmorten del extremo proximal del tallo; el de color rubio tiene raíz en fase telógena.
– (encontrados en el cadáver n° 3).- (página 72 del informe)

Muestra n° 4 del apartado 38°
-Cinco vellos; tres de los vellos tienen raíces en fase telógena, uno catágena con desprendimiento postmorten y otro presenta. ruptura postmorten del tallo.
-(encontrado en cadáver n° 3).- (página 72 del informe).

Muestras del detenido n° 25 y nº 26, -cabellos y vellos púbicos de Miguel Ricart Tárrega- (página 3 del informe).
Dos pelos de origen sexual encontrados en la cara posterior del codo izquierdo del cadáver nº 1
Un pelo de origen sexual encontrado en la mano derecha del cadáver n° 2.
El informe al que se hace referencia en las peticiones es el informe del Instituto Nacional de Toxicología emitido el 4 de marzo de 1993 (hojas XXVII y XVIII).

MÉTODO DE ANÁLISIS

1.-Extracción de ADN
La extracción de ADN de las muestras se realizó mediante un método de fenol-cloroformo seguido de concentración con microcon 100.
2.- Amplificación y secuenciación de mtDNA
Amplificación por PCR de la región control del mtDNA
Se han empleado los siguientes iniciadores – (primers), realizando el protocolo de amplificación según las referencias señaladas. (1,2,3)
PRIMERS REGIÓN CONTROL
.L15997 5′ CACCATTAGCACCCAAAGCT’ 3′
.H408 5′ CTGTTAAAAGTGCATACCGCCA3′
El producto amplificado obtenido se ha comprobado en minigeles de poliacrilamida con gradiente de concentración 8/25, con posterior visualización mediante tinción argéntica, según protocolo descrito por Barros. (4)
Asimismo, se han empleado controles negativos y positivos en cada análisis realizado.
Nested-PCR de la región hipervariable HV1
Se ha realizado la amplificación de la región control para la zona hipervariable HV1, empleando los iniciadores descritos a continuación, y siguiendo el protocolo descrito en las referencias (2) .También en este caso se han empleado controles negativos y positivos.

PRIMER DE LA REGIÓN HIPERVARIABLE HV1
Estudio de la cadena H:
Primers para la amplificación:
L15997 5′ CACCATTAGCACCCAAAGCT’3′
H16401 5’TGATTTCACGGAAGGATGGTG 3
Primer para la secuenciación
H16401 F- 5’TGATTTCACGGAAGGATGGTG 3
Secuenciación cíclica mediante secuenciador automático (ALF- Pharmacia, UPEsala, Suecia)
Se han secuenciado todas las muestras, para la zona hipervariable 1 (HV1).
Comparación de resultados
Las secuencias obtenidas son comparadas con la secuencia “Anderson” (5) de referencia. Se comunican únicamente variaciones respecto a dicha secuencia control.
Otras consideraciones en relación con el análisis de ADN mitocondrial
Al ser de muy reciente introducción en el campo forense el análisis de ADN mitocondrial no está actualmente incorporado a controles de calidad nacionales e internacionales. Sin embargo el uso de ADN mitocondrial ha sido validado para uso forense (3) y ha sido estandarizado su uso por la EDNAP (Europea DNA Profiling Group) (Bruselas, Marzo, 1997) Se
disponen, asimismo, de frecuencias de HV1 en poblaciones españolas.
Referencias:
1.-Hopgood R, Sullivan KM, Gill P (1992) : Strategies for automated
Sequencing of Hurnan Mitocondrial ONA directly from PCR products.
Biotechniques 14(1): 82-92.
2.-Sullivan KM, Hopgood R y Gill P (1992) ídentification of human remains
by amplification and automated sequencing of mitocondrial DNA.
International Journal of Legal Medicine 105:83-86.
3.-Wilson MR, DiZinno JA, Polanskey D, Reploge J, Budowle B. (1995) :
Validation of mitochondrial DNA sequencing for forensic casework analysis.
International Journal of Legal Medicine, 108:68-74.
4.- Barros F, Lareu MV y Carracedo A. (1992) Detection of polyrnorphisms
of hurnan DNA after PCR by miniaturized SOS- polyacrylamide gel
electrophoresis. Forensic Science International,55:27-36.
5.- Anderson S, Baker AT, Barrell BG, de Brujin MHL, Coulson AR, Orouin
J, Eperin lC, Nierlich OP, Roe BA, Sanger F, Scheier PH, Smith AJH, Staden
R, Young IG (1981). Sequence and organization of the human mitochondrial
genome. Nature, 290: 457-465.

RESULTADOS

informecarracedotabla-1

CONCLUSIONES

PRIMERA.- Todas las muestras solicitadas por la Audiencia Provincial de Valencia han sido analizadas a excepción de los pelos pertenecientes a Miguel Ricart Tárrega debido a que el estudio del ADN mitocondrial se realizó en la sangre del mismo.

SEGUNDA. – En tres de los pelos analizados, los rotulados como M-3,3′; M-4 zapato 1; y uno de los pelos recogidos en el codo izquierdo del cadáver número 1, la amplificación de ADN mitocondrial ha dado resultados negativos, por la que la secuencia no pudo ser obtenida.

TERCERA.- El resto de los pelos analizados la amplificación ha dado resultados positivos, obteniéndose las secuencias correspondientes de ADN mitocondrial.

CUARTA.- La secuencia de ADN mitocondrial obtenida de la sangre de Miguel Ricart Tárrega presenta una variación en la posición 16298 donde cambia una C por una T con respecto a la secuencia Anderson de referencia.

QUINTA.- Ninguna de las secuencias de ADN mitocondrial obtenidas de los pelos analizados coinciden con la secuencia de ADN mitocondrial obtenida de la Sangre de Miguel Ricart Tárrega, por lo que se puede afirmar que ninguno de dichos pelos pertenecían a Miguel Ricart Tárrega.

 

En Santiago a 30 de Abril de 1997

Fdo. Prof. Dr. Ángel Carracedo Fdo. Profa. Dra. Mª Victoria Lareu

El profesor Carracedo.

Prof. Dr. Ángel Carracedo

 

comentarios
  1. bartos Rodriguez dice:

    El caso de estos crímenes los seguí con mucha atención,por presumirse que en el caso había personas,que no era conveniente dar a conocer. Lo espeluznante de los asesinatos,hicieron que muchos ciudadanos cómo yó,sintieramos la necesidad de llevar a los tribunales a los que realmente eran culpables. No sucedió así,y cómo és costumbre se echó tierra por medio. Pero no puedo olvidar la valentía de Fernando, del señor Blanco y del Dr, Frontela y otros por enfrentarse al sistema,con todas las consecuencias.

  2. Nicole dice:

    Porque no se hacen pruebas de ADN Filial. Es que en Espana no hay un base de datos con DNA de sujetos que han estado presos o han cometido crimenes? Tiene que haber alguna forma de investigar esos pelos y compararlos poco a poco a grupos familiares para dar con los asesinos. Se les hace prueba a 100 personas del area, de alli a los familiares de las personas que tienen mas grados de posibiliades de ser familia de los donates de esos pelos. Es complicado, pero no imposible.

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s